ID: 969617487

View in Genome Browser
Species Human (GRCh38)
Location 4:8262176-8262198
Sequence AGAGACCCACAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969617480_969617487 -2 Left 969617480 4:8262155-8262177 CCACAAGGTCTGTGCTGACCCAG No data
Right 969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG No data
969617479_969617487 12 Left 969617479 4:8262141-8262163 CCTGCACAAAGATACCACAAGGT No data
Right 969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969617487 Original CRISPR AGAGACCCACAGATGGGGCA GGG Intergenic
No off target data available for this crispr