ID: 969617487 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:8262176-8262198 |
Sequence | AGAGACCCACAGATGGGGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
969617480_969617487 | -2 | Left | 969617480 | 4:8262155-8262177 | CCACAAGGTCTGTGCTGACCCAG | No data | ||
Right | 969617487 | 4:8262176-8262198 | AGAGACCCACAGATGGGGCAGGG | No data | ||||
969617479_969617487 | 12 | Left | 969617479 | 4:8262141-8262163 | CCTGCACAAAGATACCACAAGGT | No data | ||
Right | 969617487 | 4:8262176-8262198 | AGAGACCCACAGATGGGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
969617487 | Original CRISPR | AGAGACCCACAGATGGGGCA GGG | Intergenic | ||
No off target data available for this crispr |