ID: 969618012

View in Genome Browser
Species Human (GRCh38)
Location 4:8265022-8265044
Sequence TGCACTGCTGTCCCCACCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969618005_969618012 12 Left 969618005 4:8264987-8265009 CCTGCAGTGGGGGTCCTGGGAAC No data
Right 969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG No data
969618010_969618012 -2 Left 969618010 4:8265001-8265023 CCTGGGAACAGGGAGGCCGGATG No data
Right 969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG No data
969618004_969618012 13 Left 969618004 4:8264986-8265008 CCCTGCAGTGGGGGTCCTGGGAA No data
Right 969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969618012 Original CRISPR TGCACTGCTGTCCCCACCCG TGG Intergenic
No off target data available for this crispr