ID: 969618325

View in Genome Browser
Species Human (GRCh38)
Location 4:8266465-8266487
Sequence TAGGTACAGAAAGCCGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969618325_969618331 12 Left 969618325 4:8266465-8266487 CCTAGCTCGGCTTTCTGTACCTA No data
Right 969618331 4:8266500-8266522 AACTGGCATTCCCCCTTGAGGGG No data
969618325_969618330 11 Left 969618325 4:8266465-8266487 CCTAGCTCGGCTTTCTGTACCTA No data
Right 969618330 4:8266499-8266521 TAACTGGCATTCCCCCTTGAGGG No data
969618325_969618327 -5 Left 969618325 4:8266465-8266487 CCTAGCTCGGCTTTCTGTACCTA No data
Right 969618327 4:8266483-8266505 ACCTATAAAATGGCTGTAACTGG No data
969618325_969618329 10 Left 969618325 4:8266465-8266487 CCTAGCTCGGCTTTCTGTACCTA No data
Right 969618329 4:8266498-8266520 GTAACTGGCATTCCCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969618325 Original CRISPR TAGGTACAGAAAGCCGAGCT AGG (reversed) Intergenic
No off target data available for this crispr