ID: 969619158

View in Genome Browser
Species Human (GRCh38)
Location 4:8270243-8270265
Sequence GTTGGCATAGGTGTGCCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969619158_969619162 -4 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619162 4:8270262-8270284 CAACGTGTGCGCGCTGCAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 71
969619158_969619165 24 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95
969619158_969619166 25 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
969619158_969619160 -7 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619160 4:8270259-8270281 TGCCAACGTGTGCGCGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969619158 Original CRISPR GTTGGCATAGGTGTGCCCGT CGG (reversed) Exonic
900119789 1:1043640-1043662 GCTGGGGTACGTGTGCCCGTCGG - Exonic
901316920 1:8315782-8315804 GTTGGCAGAAGTGTGCCTGATGG - Intergenic
903122784 1:21227191-21227213 GGTGGCATAGGTGTCGTCGTGGG - Exonic
907393263 1:54172522-54172544 GCTGGCAGTGGTGTGCCCCTGGG + Intronic
911648980 1:100365680-100365702 GTTGGCATCAGTGTGACTGTGGG + Intronic
922418484 1:225443241-225443263 GTTACCATGGGTGGGCCCGTGGG - Intergenic
922616573 1:226964556-226964578 GTGGGCTTAGGTGGGCCCGTCGG + Intronic
924374743 1:243393423-243393445 GTTTGCAGTGGTGTGCCCATTGG + Intronic
1064327639 10:14365627-14365649 GTTGACATAGGTGGGAACGTGGG - Intronic
1096357791 12:50957144-50957166 GTTGGCATATGTGTGTCTATGGG - Intronic
1105874472 13:24540508-24540530 GTGGGCAGAGGTGTGGCCCTGGG - Intergenic
1108098274 13:46927856-46927878 GTTGGTCTAGGTGTGCACATAGG + Intergenic
1116037955 14:39651058-39651080 GTTGGCATAGAAGTGCATGTGGG + Intergenic
1121214710 14:92238893-92238915 GCAGGCACAAGTGTGCCCGTGGG - Intergenic
1121571823 14:94952050-94952072 GTGGGTATAGGTGTGCATGTGGG - Intergenic
1125514517 15:40310272-40310294 TCTGGCATAGGTGTTCCCGTGGG - Intergenic
1131957499 15:97752029-97752051 GCAGGAATAGGTGTGCCCCTCGG + Intergenic
1133317839 16:4895093-4895115 GGCGGCATAGGGGTGCCAGTTGG + Intronic
1143742120 17:8962047-8962069 GGTGGCCTAGGTGTTCCTGTGGG - Intronic
1147119903 17:38329830-38329852 GGTGGCAGAGGTATGCCCCTGGG - Exonic
1147442632 17:40456755-40456777 GTGAGCATGGGTGTGCCCTTGGG + Exonic
1151370055 17:73642177-73642199 GATGGCACAGGTGTGGACGTGGG + Intronic
1152551105 17:81030776-81030798 TTTGGCATAGGCGGGCCCGGGGG - Intergenic
1153698922 18:7672895-7672917 GGTGGCCTAGGTGTGCACGCAGG - Intronic
1160914812 19:1491412-1491434 CATGGCCTCGGTGTGCCCGTCGG - Intronic
1163699709 19:18781162-18781184 GATGGCACAGATGTGCCCCTGGG + Exonic
929956266 2:46460891-46460913 GGGGGCATAGGTGTGGCCATGGG - Intronic
941684981 2:168439027-168439049 GTTTGCATAGGTTTGCATGTAGG - Intergenic
1175324570 20:58113953-58113975 GCTGGCACATGTGAGCCCGTGGG - Intergenic
1176097510 20:63351090-63351112 GTGGGCATGGGTGTGGCAGTGGG - Intronic
1176672468 21:9747256-9747278 GTGGGCAAAATTGTGCCCGTTGG + Intergenic
1179920359 21:44504050-44504072 GTTGGCCTCGGTGAGCCCTTGGG + Intronic
1180390462 22:12277199-12277221 GTTCATATAGGTGTGTCCGTAGG + Intergenic
1180409281 22:12587558-12587580 GTTCATATAGGTGTGTCCGTAGG - Intergenic
1183409104 22:37644671-37644693 GTTGGCATAGGAGTCCTCCTTGG - Exonic
950131145 3:10547463-10547485 GTTAGGAAAGGTGTGACCGTGGG - Intronic
954466847 3:50660331-50660353 GTGAGCATAGGTGTGGCCTTTGG - Intergenic
967948381 3:194822037-194822059 GGTGACATACGTGTGCCCATTGG + Intergenic
969619158 4:8270243-8270265 GTTGGCATAGGTGTGCCCGTCGG - Exonic
971259124 4:25040354-25040376 GTTTGCAGAGGTGTGCTCTTTGG + Intergenic
985402262 4:189604575-189604597 GTGGGCAAAATTGTGCCCGTTGG - Intergenic
985829218 5:2215622-2215644 GTTGGCAGAGGTGGGCAGGTGGG + Intergenic
986124192 5:4869999-4870021 GTTCACACTGGTGTGCCCGTTGG - Intergenic
987325573 5:16809254-16809276 CTTGGCATTGGGGTGCCCTTGGG - Intronic
998862996 5:146463628-146463650 GTTTGCACAGGTGTGGCTGTAGG - Exonic
1002781962 6:373822-373844 TTTGGCATAGGCATGCCAGTGGG + Intergenic
1003248679 6:4405659-4405681 GGTGGCATGGGTTTGCCAGTGGG - Intergenic
1016778601 6:147933973-147933995 ATTGCCATGGGTGTGCCCCTGGG + Intergenic
1017470629 6:154734045-154734067 GGTGGCCTAGCAGTGCCCGTGGG + Intronic
1026858178 7:73768716-73768738 GGTGGCAGAGATGTGCCCCTGGG - Intergenic
1029180249 7:98695455-98695477 GTTGGCTTAGGAGTGCGGGTCGG - Intergenic
1029929361 7:104354405-104354427 GTTAGCATATGTGTGCCCTATGG - Intronic
1031922212 7:127610755-127610777 GTGGGCATAGGGGTGCTCATAGG + Exonic
1032781771 7:135169934-135169956 ATTGGCAAAGGTGTGCCCCATGG - Intronic
1033629915 7:143147582-143147604 GTTGGGAGATGTGTCCCCGTTGG - Intergenic
1040313219 8:46247529-46247551 GGTGGCATAGGTGTGCCGCAGGG + Intergenic
1049738520 8:144222760-144222782 GTGGGTATAGGTGTGGGCGTTGG + Intronic
1057068525 9:92076333-92076355 ATTGGCATAGGTGTTTCCTTGGG - Intronic
1194597491 X:95876644-95876666 GTTGGCAGAGGTTTGCAGGTGGG + Intergenic