ID: 969619159

View in Genome Browser
Species Human (GRCh38)
Location 4:8270255-8270277
Sequence CAGCGCGCACACGTTGGCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969619159_969619166 13 Left 969619159 4:8270255-8270277 CCTATGCCAACGTGTGCGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
969619159_969619165 12 Left 969619159 4:8270255-8270277 CCTATGCCAACGTGTGCGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969619159 Original CRISPR CAGCGCGCACACGTTGGCAT AGG (reversed) Exonic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
903492894 1:23743271-23743293 CAGCGCGCACACTTGGGCCAGGG + Exonic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG + Exonic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1110642456 13:77841397-77841419 CAGTGAGAACACGTGGGCATAGG + Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1113673809 13:112194792-112194814 GAGCGCGGAAACGCTGGCATGGG - Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1136399837 16:30011267-30011289 GAGCGTGCACACGTGGGCACGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1164463372 19:28467067-28467089 CAGGGCGTGCACGATGGCATTGG - Intergenic
1164934220 19:32198536-32198558 CAGCAGGAACACGTTGTCATAGG - Intergenic
1167253960 19:48416011-48416033 CAGCGCGCAGACATGGCCATCGG + Exonic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
932262269 2:70336874-70336896 CAAAGCCCACAGGTTGGCATTGG - Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
945761409 2:213920406-213920428 ATGCACACACACGTTGGCATGGG + Intronic
1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG + Intergenic
1183122407 22:35740162-35740184 CAGAGGGCACACGCTGGCTTAGG + Intronic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
967633155 3:191770657-191770679 CAGCTCTCACACATTGTCATGGG - Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
996542117 5:124641290-124641312 CACCACACCCACGTTGGCATGGG - Exonic
997606509 5:135178956-135178978 CAGAGCGCACACGTTGACTGAGG + Intronic
999256657 5:150213374-150213396 CAGAGACCACACGTTGGCAGTGG - Intronic
1019348960 7:544269-544291 CAGCGTGCAGAGGTTGGCCTAGG - Intergenic
1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG + Intronic
1056464317 9:86838938-86838960 CCGCACGCACACGTAGGCACAGG - Intergenic
1057049653 9:91914110-91914132 CAGCAAGCACACGGGGGCATTGG - Intronic
1188932284 X:36126290-36126312 CAGTGAGAACACGTTGACATAGG - Intronic
1201297806 Y:12479594-12479616 CAGCGCAACCACGTGGGCATGGG - Intergenic