ID: 969619161

View in Genome Browser
Species Human (GRCh38)
Location 4:8270261-8270283
Sequence CGCCTGCAGCGCGCACACGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969619161_969619165 6 Left 969619161 4:8270261-8270283 CCAACGTGTGCGCGCTGCAGGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95
969619161_969619166 7 Left 969619161 4:8270261-8270283 CCAACGTGTGCGCGCTGCAGGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969619161 Original CRISPR CGCCTGCAGCGCGCACACGT TGG (reversed) Exonic
901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG + Exonic
901559994 1:10062570-10062592 CGCCTGCAGCCCCAACACTTTGG - Intronic
903492888 1:23743265-23743287 AGCCCCCAGCGCGCACACTTGGG + Exonic
916679967 1:167094908-167094930 GGCCTGCACCGCCCTCACGTTGG - Exonic
921671097 1:217925038-217925060 CGCCGGCCGCGGGCACACGGAGG - Intergenic
1064062441 10:12149347-12149369 CGCCTGCAGTCCCCACACTTTGG - Intronic
1065483616 10:26216762-26216784 CGCCCGCAGCTCGCACTCGCAGG + Exonic
1065768454 10:29054096-29054118 CACCTGCATTGCACACACGTGGG - Intergenic
1067145325 10:43689773-43689795 AGCCTGCACCGCGCACAAGGCGG - Intergenic
1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG + Exonic
1090659423 11:128871030-128871052 CGCCTTCAGCCCACACAGGTGGG - Intergenic
1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG + Intergenic
1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG + Intronic
1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG + Exonic
1122940287 14:104978147-104978169 CGCCTGCAGCCCGCTCCCCTGGG - Intronic
1123025783 14:105423090-105423112 CGCCTGCAGCTTGCTCATGTGGG + Intronic
1132149073 15:99447094-99447116 CGCCTGGGGCGCACACACCTGGG + Intergenic
1132903065 16:2268686-2268708 CGCCTGCCGCGCCCACCCGGTGG - Intergenic
1133369925 16:5239681-5239703 CGCCCGCACCGCGGACACGCCGG - Intergenic
1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG + Intergenic
1142167797 16:88602142-88602164 TGCCTGCAGCGGGCACAGGTAGG - Intronic
1146827908 17:36039919-36039941 CACCTGCAGTTCGAACACGTTGG - Intergenic
1147702500 17:42404738-42404760 CTCCAGCAGCGCGTGCACGTCGG + Exonic
1152420585 17:80190865-80190887 CTTCTGCAGCTCGCACACCTGGG - Exonic
1152557017 17:81058496-81058518 CGCCTGCAGCACCACCACGTGGG - Intronic
1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG + Exonic
1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG + Intronic
1152924276 17:83080212-83080234 CGCCTGCAGCGCGGCCGGGTGGG + Intronic
1161306710 19:3572922-3572944 CGCCCGCAGCCCGCCCCCGTCGG - Exonic
1163535267 19:17872999-17873021 CCCCTCTAGCGCGCACACGTGGG - Intronic
1164243425 19:23409870-23409892 GGCCTGCAGGGTGGACACGTTGG - Intergenic
1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG + Intergenic
1166748235 19:45152060-45152082 CGCCTCCAGGGCGCCCCCGTCGG - Exonic
1166862888 19:45819937-45819959 GGCCTGCAGCGTGCACGCCTGGG + Intronic
925044748 2:764381-764403 AGCCTGCAGCTCCCACACCTCGG + Intergenic
937149904 2:119679183-119679205 GCCCTGCCGCGCGCACATGTAGG + Exonic
1183677683 22:39308969-39308991 CGCCTGCAGCGCGGAGACGCTGG - Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
969629180 4:8325579-8325601 GGCCTGCAGTGCGGACAGGTTGG - Intergenic
979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG + Intergenic
998142797 5:139709582-139709604 CCCCAGCAGCGCGCACAGGGAGG - Intergenic
1007914074 6:45544571-45544593 CTTCTGCAGGGGGCACACGTTGG + Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013808695 6:114020445-114020467 CTCCTGCAGCGCCCAGATGTCGG + Intergenic
1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG + Exonic
1022741749 7:33129063-33129085 CGCCACCAGGGCGCACACGCTGG + Intergenic
1046934582 8:119874010-119874032 GGACTGCAGCGGGCACGCGTTGG - Intronic
1060803091 9:126556994-126557016 GGCCAGCAGAGCGCACACATGGG - Intergenic
1193940873 X:87679748-87679770 CGCCTGCAGCCCCAACACTTTGG - Intergenic
1198087179 X:133292731-133292753 CTCCTGCAGTGGGCACAGGTTGG - Intergenic