ID: 969619165

View in Genome Browser
Species Human (GRCh38)
Location 4:8270290-8270312
Sequence CGCCGCGCGCTGCAGCTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969619158_969619165 24 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95
969619159_969619165 12 Left 969619159 4:8270255-8270277 CCTATGCCAACGTGTGCGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95
969619161_969619165 6 Left 969619161 4:8270261-8270283 CCAACGTGTGCGCGCTGCAGGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG 0: 1
1: 0
2: 2
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969619165 Original CRISPR CGCCGCGCGCTGCAGCTCTC CGG Exonic
900546088 1:3230057-3230079 CGCATCCCCCTGCAGCTCTCTGG + Intronic
901177261 1:7313447-7313469 CGTCTACCGCTGCAGCTCTCAGG - Intronic
904847404 1:33430710-33430732 CGCCGCGCTCTGCCGGTCGCCGG + Intronic
909075606 1:71047608-71047630 CCCCTCCCGCTGCGGCTCTCTGG - Exonic
918458632 1:184754159-184754181 CGCTGCGCGCTGGAGTTCTGCGG - Intronic
921604426 1:217137755-217137777 CCCCGCGCGCCTCCGCTCTCTGG + Intronic
1075258224 10:120942151-120942173 CACCGCGCCCTGCCGCTCACAGG - Intergenic
1080456935 11:32427125-32427147 GGCCTCGCGCTGCTGCTCCCCGG + Intronic
1080910657 11:36594678-36594700 CTCCGGGCGCTGCAGCCTTCCGG - Exonic
1081636824 11:44727139-44727161 CGCCTCGCGCTGCGGGTCCCCGG + Intronic
1082838350 11:57668099-57668121 GGCCGCGCGCTGCTTCTCTGAGG + Exonic
1083296432 11:61717933-61717955 GCCCGCTCGCTTCAGCTCTCAGG - Intronic
1085208134 11:74749292-74749314 CGGCGCGGGCGGCAGCGCTCGGG - Exonic
1089556250 11:119317228-119317250 CCCCGCGCGCCGCAGCCCTAGGG + Intronic
1091026016 11:132141939-132141961 TGCCCCGCACTGCAGCCCTCTGG - Intronic
1095687377 12:45051028-45051050 CTCCGCGCGCTCCAGCCCTGCGG - Exonic
1096781486 12:53994766-53994788 CCTCGCGCGCTGCCGCTCGCGGG - Intronic
1102504443 12:113374788-113374810 CTCAGCCTGCTGCAGCTCTCTGG + Exonic
1103595441 12:122022243-122022265 CGCTGCGCCCCGCGGCTCTCTGG - Intronic
1104444636 12:128823478-128823500 CGCCGCCCGCTGCTGCTCACCGG - Exonic
1104739936 12:131164795-131164817 CGCCGCGGGCCGCACCTCTCTGG + Intergenic
1104792543 12:131493170-131493192 CGCCGCGGGCCGCACCTCTCTGG - Intergenic
1105900023 13:24745857-24745879 GGCCGCCCGCTGCAGCGCTGGGG - Intergenic
1105943536 13:25171175-25171197 CGCCGGGCCCTGCGGCTCTGGGG + Exonic
1109037756 13:57286945-57286967 GGCCGCGCGCTGGCGCTCGCTGG - Intergenic
1113846455 13:113394287-113394309 CTCCGCGGGCAGCAGGTCTCTGG - Intergenic
1119475280 14:74923250-74923272 CGCCGCGGGCCGCTGCTTTCCGG + Intronic
1122055320 14:99094131-99094153 CTCCGCGGGCTGCAGCTTCCTGG + Intergenic
1122779125 14:104136274-104136296 CGCCGCGCGCCCCCGCGCTCCGG - Intergenic
1124426873 15:29570364-29570386 CGCCCCGCGCTGCAGCTACTCGG + Intronic
1128866073 15:71115838-71115860 CGCCGCGGGCTGCGCCGCTCCGG + Intronic
1129894022 15:79090567-79090589 CGCTGCGCGCTGCCTCTCTCTGG + Exonic
1130040906 15:80404567-80404589 CGCCGCCCGCCGCAGCCCGCAGG + Intronic
1132855569 16:2043163-2043185 CACCTTGCTCTGCAGCTCTCAGG + Intronic
1138658896 16:58506543-58506565 CCCTGCTCCCTGCAGCTCTCCGG + Exonic
1142136221 16:88453168-88453190 TGCCGGGCCCTGCACCTCTCCGG - Intergenic
1145077411 17:19867496-19867518 CGCCGCACGCTGGCGCGCTCCGG - Exonic
1146034147 17:29390967-29390989 CGCAGCCCCCTGCAGCGCTCCGG - Exonic
1147994934 17:44355141-44355163 CACCGCAAGCTGCAGCTCTCGGG - Exonic
1150373713 17:64662524-64662546 CGGCGGGCGCGGCAGCTCTGTGG + Intergenic
1151581577 17:74982250-74982272 CCTCGCGCGCTGCACATCTCGGG - Intergenic
1151961802 17:77409552-77409574 CTCCGCCCCCTGCAGCTCTGTGG + Intronic
1152362074 17:79837423-79837445 CACCTCGCGGTGCAGCTCTGAGG - Intronic
1152794075 17:82298386-82298408 AGCCGCTCGCTGCAGCTCTGAGG - Intergenic
1161215794 19:3094547-3094569 CGCCGCCCGCCGCGGCCCTCCGG - Exonic
1163398112 19:17075841-17075863 CGCCGCGCGCCGCCGGTCCCGGG - Exonic
1165300325 19:34964256-34964278 CGCCGCCGCCTGCAGCCCTCGGG + Intergenic
925178128 2:1799040-1799062 CCCCCAGCTCTGCAGCTCTCAGG - Intronic
932760486 2:74436328-74436350 CGCCTCCAGCTGCAGCGCTCAGG + Intronic
932773996 2:74516224-74516246 AGCCGCGCGCTCCACCGCTCCGG - Exonic
934714671 2:96536777-96536799 AGCCGCGCGCTGAGGGTCTCGGG + Exonic
942965871 2:181891942-181891964 CGGCGCCCGCTTCAGCTCCCCGG + Exonic
946422242 2:219571398-219571420 GGCCCCGAGCTGCAGCTCTGCGG + Intronic
947625303 2:231614873-231614895 CACCGCGCGCAGCAGCTCCCGGG + Intergenic
948943830 2:241209579-241209601 CGGCGCGCGCGGCTCCTCTCAGG - Exonic
1171465976 20:25328302-25328324 CACCCTGGGCTGCAGCTCTCAGG - Intronic
1171994869 20:31723456-31723478 GGCCGGGGGCTGCACCTCTCCGG + Intronic
1173807461 20:45935084-45935106 CGCCGCGCGCTCCCGCCCCCGGG - Intronic
1175961084 20:62636657-62636679 CGGCGCGTGCTGCACCTCCCTGG - Intergenic
1176410448 21:6446968-6446990 CGCCTCACCCTGCAGATCTCAGG + Intergenic
1178162855 21:29939291-29939313 CGCCGCGCGCTGCCTCGCCCGGG + Intronic
1179685941 21:43055290-43055312 CGCCTCACCCTGCAGATCTCAGG + Intronic
1182123230 22:27800038-27800060 CGCTGCGGGCCGAAGCTCTCAGG + Exonic
1182567651 22:31212190-31212212 CGCCCCGCCCCGCCGCTCTCAGG - Intergenic
1183586626 22:38756372-38756394 ACCCGCGCGCTGCCGCTCCCAGG - Intronic
1183931214 22:41237267-41237289 CTCCTGGAGCTGCAGCTCTCGGG - Exonic
1184744007 22:46445734-46445756 AGCCAGGCGCTGCTGCTCTCGGG - Intronic
958641493 3:96813379-96813401 GGCCGGGCTCTGCAGCGCTCCGG + Intergenic
961377238 3:126475360-126475382 CGCCGCGCGCCCCAGGCCTCCGG - Exonic
966849428 3:184155552-184155574 CGCCGCGCGCCGCCGCCGTCTGG + Exonic
967876529 3:194271521-194271543 CCCCTCCTGCTGCAGCTCTCTGG - Intergenic
968225543 3:196969877-196969899 CGCGTCGCGCCGCAGCTCGCGGG - Intergenic
968878254 4:3285619-3285641 AGCCGCGCGCTTAACCTCTCGGG + Intergenic
969619165 4:8270290-8270312 CGCCGCGCGCTGCAGCTCTCCGG + Exonic
972607727 4:40629769-40629791 CGCCGCGCGCTCCCGGCCTCGGG - Intronic
982745780 4:159103307-159103329 CGGCCCGGGCTGCAGCCCTCCGG - Intergenic
985248087 4:187996657-187996679 CCCCTCGCCCTGCAGCTCGCCGG - Intronic
985696704 5:1344985-1345007 CGCCGCGCGCCGCAGACCGCCGG + Exonic
986315193 5:6582537-6582559 AGCCAGGCGCTGCAGCTCTTTGG + Intergenic
995140239 5:108727936-108727958 GGCCTGGCGCTGCGGCTCTCGGG - Intergenic
998414134 5:141933308-141933330 AGCCGCGGGCTGCAGCTTTCTGG - Exonic
999925019 5:156366137-156366159 CCCAGCGCGATGCTGCTCTCAGG - Intronic
1002505851 5:179678663-179678685 CGGCGCGCGCCGCAGCCGTCGGG + Exonic
1002540206 5:179901697-179901719 CACAGCTCACTGCAGCTCTCTGG - Intronic
1006706327 6:36024454-36024476 CGCCGGGGGCTGCAGGTCCCAGG - Intronic
1008629285 6:53348410-53348432 CGCCGCGCGCTCCGGCCCGCAGG + Intronic
1016990074 6:149922664-149922686 CGTCGCCCTCTGCAGCCCTCTGG + Intronic
1018013486 6:159692928-159692950 CGCCGCGCGCTGCCGTTCCTCGG - Intronic
1018836303 6:167486775-167486797 TGCCGGGGGCTCCAGCTCTCTGG + Intergenic
1023846629 7:44124353-44124375 CGCCGCGCGCTGATTCTCCCAGG + Intronic
1024090900 7:45939090-45939112 CCCCGCCCCCTGCTGCTCTCAGG - Intergenic
1027250001 7:76393154-76393176 CGCCGCGTGGTGCAGCTGTGAGG - Intronic
1031096556 7:117427488-117427510 CCGCGCGCCCTTCAGCTCTCCGG + Exonic
1031895948 7:127347887-127347909 GGCAGCGTGCTGGAGCTCTCGGG + Intronic
1034227965 7:149497583-149497605 CGCCGCGCGCGGCACCACGCAGG + Exonic
1040652487 8:49464891-49464913 CACCGCGCCCTGCAGCTCTCGGG - Intergenic
1042591601 8:70403043-70403065 CGCCCCGCGCTGCAGCTCGCCGG + Intronic
1043053228 8:75407355-75407377 CGCCCCGCGCTGGACCGCTCGGG - Intergenic
1047499274 8:125429757-125429779 CGCCGCTCGCTGCAGCCCCGCGG - Intergenic
1048072830 8:131040080-131040102 CACCACGCGCCGCAGCTGTCAGG - Exonic
1049415468 8:142492928-142492950 CGCCGGCCGCGGCAGCTCTCGGG + Intronic
1049457367 8:142700490-142700512 CGCCGCGCGCTGACCCTCCCTGG + Exonic
1052656008 9:31362066-31362088 CGCCGCGAGCTCCACCTCCCAGG + Intergenic
1057716947 9:97502557-97502579 GAGCGCGCCCTGCAGCTCTCAGG - Intronic
1060004407 9:119986877-119986899 AGCAGCGCCCTGCAGGTCTCGGG + Intergenic
1062432677 9:136533000-136533022 CACAGAGCTCTGCAGCTCTCTGG - Intronic
1195100270 X:101549136-101549158 CCCAGCGGGCTGCACCTCTCAGG + Intergenic