ID: 969619166

View in Genome Browser
Species Human (GRCh38)
Location 4:8270291-8270313
Sequence GCCGCGCGCTGCAGCTCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969619159_969619166 13 Left 969619159 4:8270255-8270277 CCTATGCCAACGTGTGCGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
969619158_969619166 25 Left 969619158 4:8270243-8270265 CCGACGGGCACACCTATGCCAAC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
969619161_969619166 7 Left 969619161 4:8270261-8270283 CCAACGTGTGCGCGCTGCAGGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG 0: 1
1: 0
2: 1
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969619166 Original CRISPR GCCGCGCGCTGCAGCTCTCC GGG Exonic
900240681 1:1615924-1615946 GCCGCGCGCCGCAGCCCACCCGG - Intronic
900657955 1:3769396-3769418 TCCGCTCACTGCAGCTCCCCTGG + Intronic
901525861 1:9823389-9823411 GGCGCGCGCTGCAGGCGTCCCGG - Intronic
904058313 1:27686692-27686714 GCTGCCAGCTGCAGCTCTGCAGG + Intergenic
907243479 1:53093216-53093238 GCCCGGCTCTGCTGCTCTCCTGG - Intronic
913681081 1:121187165-121187187 TCCGGGCGCTGCAGTTCTCCCGG + Exonic
913703618 1:121397177-121397199 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
913979968 1:143498888-143498910 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
914032911 1:143974805-143974827 TCCGGGCGCTGCAGTTCTCCCGG + Intergenic
914074317 1:144324372-144324394 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
914104859 1:144642074-144642096 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
914156535 1:145093161-145093183 TCCGGGCGCTGCAGTTCTCCCGG - Exonic
915980238 1:160415804-160415826 GCCGCGCCTTGTAGCGCTCCAGG - Exonic
918216089 1:182392416-182392438 GCCGCCCGCTCCGGCTCTCTTGG + Intergenic
920468393 1:206205689-206205711 TCCGGGCGCTGCAGTTCTCCCGG + Intronic
921051601 1:211515430-211515452 GGCGCCCGCTTCAGCTCTCCCGG + Intergenic
923650236 1:235866865-235866887 GCCGCGCACTCCCCCTCTCCCGG + Exonic
924206020 1:241712195-241712217 GCCGGGGGCTCCAGGTCTCCTGG - Intronic
1064208982 10:13347834-13347856 GCCCGGCGCTGCCCCTCTCCAGG + Intronic
1066080752 10:31928664-31928686 CCCGCGCCCTGCACCTCACCGGG + Exonic
1066954123 10:42149424-42149446 GCCGGGCGCTGCAGCCCTGCAGG - Intergenic
1073043266 10:100621565-100621587 GCCGCCCGCTGTAAATCTCCCGG - Intergenic
1073284945 10:102382082-102382104 GCCGCCAGCAGCAGCTCCCCAGG + Exonic
1073427244 10:103462762-103462784 CCCTCACGCTGCTGCTCTCCTGG + Intergenic
1076780890 10:132723801-132723823 GCCCCGGGCTGCCGCTCTCCTGG + Intronic
1077145061 11:1040981-1041003 GCCGGGCAGTGCAGCTCACCCGG + Intergenic
1081265514 11:41015963-41015985 GTCTCGCTCTGCAGCTCGCCCGG - Intronic
1083333130 11:61908257-61908279 GCCGCCCCTTGCAGCTGTCCCGG - Exonic
1084153301 11:67301210-67301232 TCCGGCCCCTGCAGCTCTCCAGG - Intronic
1089604573 11:119634494-119634516 GCCACGCTCCGCAGCTGTCCGGG - Intronic
1091418936 12:317851-317873 TCCGGGAGCTGCACCTCTCCAGG + Intronic
1095465323 12:42483382-42483404 GCCGCGCTCGGCCGCTGTCCGGG - Intronic
1095687376 12:45051027-45051049 TCCGCGCGCTCCAGCCCTGCGGG - Exonic
1095812178 12:46383239-46383261 CCCGCCCGCTGCAGCGCCCCAGG - Intergenic
1095853005 12:46831243-46831265 GCCGCGCTCGCCACCTCTCCTGG + Intronic
1096156926 12:49346174-49346196 GCCTCGCCCTGCAGCGCTCCCGG - Intergenic
1096536634 12:52279160-52279182 TACGCGCTCTGCGGCTCTCCCGG + Intronic
1096816640 12:54205863-54205885 GCTGGGTCCTGCAGCTCTCCTGG - Intergenic
1098043093 12:66371822-66371844 GCCGCGAGCTGCTGCGCTCCTGG + Exonic
1102433960 12:112905740-112905762 GCCCTGAGCTGCTGCTCTCCAGG - Intergenic
1103348297 12:120265541-120265563 GCCGCTCGCTGGCGCCCTCCTGG + Intronic
1103956032 12:124577366-124577388 CCCGTGCTCTGCAGCACTCCTGG - Intergenic
1104635319 12:130434838-130434860 GCCCCGCGCTGCTTCTCTCTAGG + Exonic
1105426890 13:20301970-20301992 GCCTCCCGCTGCACTTCTCCTGG + Intergenic
1112294639 13:98176382-98176404 GCTGCGCGCTGGAGCACTTCCGG - Exonic
1113835204 13:113324505-113324527 GCCGGGCCCTGCAGCTCTCGCGG + Intronic
1114301668 14:21384371-21384393 CCCGCGCGCGGCAGCTCTTGTGG - Intergenic
1115906953 14:38211035-38211057 GCCGCGCGGGGCCGCTGTCCAGG + Exonic
1117926046 14:60779976-60779998 CCATGGCGCTGCAGCTCTCCCGG + Intronic
1122075254 14:99231417-99231439 GGCGCGCGCTGCAGCACGGCAGG + Exonic
1123393291 15:19899428-19899450 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
1128866074 15:71115839-71115861 GCCGCGGGCTGCGCCGCTCCGGG + Intronic
1132676963 16:1124892-1124914 GCTGGGCGCTCCAGCTCCCCTGG + Intergenic
1132933825 16:2471383-2471405 GCCGGGCGGAGCAGGTCTCCCGG - Intergenic
1134230606 16:12426312-12426334 GCCGGGGCTTGCAGCTCTCCTGG + Intronic
1136699289 16:32116802-32116824 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
1136710739 16:32234582-32234604 GCCGGGCCCTGAAGCTCTGCAGG + Intergenic
1136768361 16:32811132-32811154 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
1136775719 16:32870767-32870789 GCCACCTGCTGCAGCTCGCCGGG - Intergenic
1136799780 16:33059973-33059995 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
1136867944 16:33771134-33771156 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
1136894898 16:33990745-33990767 GCCACCTGCTGCAGCTCGCCGGG + Intergenic
1137247774 16:46719532-46719554 GCCGTGGGCAGGAGCTCTCCAGG + Intronic
1137983971 16:53092200-53092222 GCGCCAGGCTGCAGCTCTCCAGG - Intronic
1138229842 16:55328860-55328882 GCCGTGCGCTGCAGCTCGAGAGG + Exonic
1140043678 16:71425841-71425863 GCCGCGCTCTCCTGCTCCCCAGG + Intergenic
1203059321 16_KI270728v1_random:955180-955202 GCCGGGCCCTGAAGCTCTGCAGG - Intergenic
1203070753 16_KI270728v1_random:1073148-1073170 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
1203078137 16_KI270728v1_random:1132876-1132898 GCCACCTGCTGCAGCTCGCCGGG - Intergenic
1203104233 16_KI270728v1_random:1345144-1345166 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
1203129281 16_KI270728v1_random:1617224-1617246 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
1142858939 17:2749500-2749522 GGCGGGCGCTGCAGATCCCCGGG - Intergenic
1144107361 17:11997818-11997840 GCAGAGCGTTGCAGCTCTGCGGG - Intergenic
1144770325 17:17755938-17755960 GCCGCTCTTTGCAGCTCACCAGG + Intronic
1145077410 17:19867495-19867517 GCCGCACGCTGGCGCGCTCCGGG - Exonic
1145765659 17:27456747-27456769 GCCGGGCGCTGCAGCAGTGCGGG + Intronic
1146445390 17:32928396-32928418 GCCGCGCCCCGGAGCGCTCCGGG + Intronic
1147994933 17:44355140-44355162 ACCGCAAGCTGCAGCTCTCGGGG - Exonic
1148760060 17:49995002-49995024 GGCGGGCGCTGCACCTCCCCAGG + Exonic
1148780223 17:50117346-50117368 CCCGGGCGCAGCAGCCCTCCCGG - Intronic
1149664910 17:58358559-58358581 GCCAGGCGCTGCTGCTCTCCTGG + Exonic
1150289401 17:63972883-63972905 GCTGCGCACTGCAGCTCCCCAGG - Exonic
1152356470 17:79810034-79810056 TCCGAGCGCTGCAGCTGGCCGGG + Intergenic
1152677255 17:81648051-81648073 GCGGCGGGCCGCAGCCCTCCAGG - Exonic
1154010365 18:10568992-10569014 GCTGTGCTCTGCAGCTCACCCGG + Intergenic
1157565347 18:48675742-48675764 GCCCCGTGCTGCTGCCCTCCTGG - Intronic
1160455201 18:78994646-78994668 TGCCCGCGCTGCGGCTCTCCAGG - Exonic
1161001343 19:1912646-1912668 GCCCCGCGCTGCTGCCCGCCGGG - Exonic
1161188333 19:2938118-2938140 CCCGAGGGCTGCTGCTCTCCTGG + Intronic
1161703034 19:5805247-5805269 GCCGCGGGCTGCGGCCATCCCGG - Intergenic
1163535500 19:17874157-17874179 GCCGCGCAGTGCGGCTCTGCGGG + Exonic
1165242950 19:34481967-34481989 GCCGGGCCATGCAGCGCTCCAGG + Exonic
1165767777 19:38361735-38361757 GCCGCGCCCGGTAGCGCTCCTGG - Exonic
1166846341 19:45730853-45730875 GCCGCGCGCTGCATCTCCCTCGG + Exonic
1166998868 19:46733143-46733165 GCCGCTCGCTGGAGCTCAACGGG - Exonic
1167898665 19:52601822-52601844 GCCGGGCCCTGCTGCTCCCCAGG + Intronic
1167909417 19:52689939-52689961 GCCGGGCCCTGCTGCTCCCCAGG - Intronic
1167946452 19:52992798-52992820 GCCGGGCCCTGCTGCTCGCCAGG - Intergenic
1167955096 19:53058015-53058037 GCCGGGCCCTGCTGCTCCCCAGG - Intergenic
1167960748 19:53102880-53102902 GCCGGGCCCTGCTGCTCCCCAGG - Intronic
1167967310 19:53158230-53158252 GCCGGGCCCTGCTGCTCCCCAGG - Intronic
1167991741 19:53366229-53366251 GCCGGGCCCTGCTGCTCCCCAGG + Intronic
1202680176 1_KI270712v1_random:2583-2605 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
926055865 2:9773578-9773600 GGGGAGCGCTGCTGCTCTCCAGG + Intergenic
927142008 2:20137121-20137143 GCCTCCGGCTGCAGCTCTCCAGG + Intergenic
932773995 2:74516223-74516245 GCCGCGCGCTCCACCGCTCCGGG - Exonic
932780182 2:74554555-74554577 GCCGGGAGCTGCAGCACCCCAGG - Exonic
933684557 2:85133278-85133300 CGCGCGCACCGCAGCTCTCCGGG + Intergenic
934251546 2:90359913-90359935 GCCGGGCGCTGCAGCAGTGCGGG - Intergenic
934258013 2:91443485-91443507 GCCGGGCGCTGCAGCAGTGCGGG + Intergenic
934714672 2:96536778-96536800 GCCGCGCGCTGAGGGTCTCGGGG + Exonic
937668441 2:124513787-124513809 CCTGCACGATGCAGCTCTCCAGG - Intronic
938303406 2:130231539-130231561 GCCAGCCGCTGCAGCTCCCCAGG - Intergenic
938368858 2:130756350-130756372 GCCGCGCCCTGCTGCACTGCGGG + Exonic
938453267 2:131442693-131442715 GCCAGCCGCTGCAGCTCCCCAGG + Intergenic
942454739 2:176130064-176130086 CCCGCGCGCCGCCGCCCTCCCGG - Exonic
942965872 2:181891943-181891965 GGCGCCCGCTTCAGCTCCCCGGG + Exonic
948401875 2:237691326-237691348 GGCGCGGGCTGGAGCCCTCCCGG + Intronic
1174563095 20:51445196-51445218 GCCCCCCGCAGCACCTCTCCAGG + Intronic
1176367559 21:6043140-6043162 GCGGGGCGCCGCAGCACTCCTGG - Intergenic
1178493697 21:33070313-33070335 GCCCCGAGCTGCAAGTCTCCGGG - Exonic
1179755960 21:43495402-43495424 GCGGGGCGCCGCAGCACTCCTGG + Intergenic
1179901673 21:44397436-44397458 GCCGCCCTCTGCAGCTCACACGG + Intronic
1179949578 21:44702261-44702283 GGGGCTCGCAGCAGCTCTCCGGG - Intronic
1179983986 21:44911016-44911038 GGGGCCCGCTGCAGCTGTCCTGG - Intronic
1180664257 22:17497218-17497240 TCAGCTCACTGCAGCTCTCCTGG - Intronic
1181848925 22:25735899-25735921 GCCCCTCTCTGCAGCTTTCCTGG + Intergenic
1183069556 22:35386778-35386800 GCCTTGCGGTGCAGCTCTTCTGG - Exonic
1183585383 22:38750282-38750304 GCCGCGAGCTGGAACTCTGCTGG + Exonic
1183586624 22:38756371-38756393 CCCGCGCGCTGCCGCTCCCAGGG - Intronic
1184018084 22:41800783-41800805 GCCGCGGGCTGCAGGTTCCCGGG + Intronic
1184533924 22:45073585-45073607 GCCTCGGGCTCCAGCCCTCCAGG - Intergenic
1184744006 22:46445733-46445755 GCCAGGCGCTGCTGCTCTCGGGG - Intronic
956452161 3:69385809-69385831 GCCGCGCGCTCCAGCTCACCTGG + Exonic
956539761 3:70323515-70323537 GCTGCGCACTGCAGAACTCCAGG + Intergenic
957506297 3:81125487-81125509 GCCACCCACTGCAGCTCTCCAGG - Intergenic
958641494 3:96813380-96813402 GCCGGGCTCTGCAGCGCTCCGGG + Intergenic
968659512 4:1793328-1793350 GCCGCGCGGTCCTGCTCTGCCGG + Exonic
968701775 4:2060892-2060914 GCCGCGCCCGGCCGCGCTCCTGG - Intronic
968904546 4:3445337-3445359 GCCGCGCACCGCAGGCCTCCAGG - Exonic
969619166 4:8270291-8270313 GCCGCGCGCTGCAGCTCTCCGGG + Exonic
969715958 4:8868249-8868271 GCCTCCCGCTGCACCGCTCCCGG + Exonic
970332627 4:15002280-15002302 GCCGCTCGCTCCCGCCCTCCCGG + Intergenic
971457347 4:26857599-26857621 GCCGCGCGCCGCTGCCCGCCCGG - Intergenic
972926588 4:44016037-44016059 GCCTGGTCCTGCAGCTCTCCTGG - Intergenic
973116918 4:46472785-46472807 GCCTCTCACTGCAGCTTTCCTGG - Intronic
975563067 4:75725104-75725126 GCCGCGCCCCGCAGCTCTGTAGG + Intronic
979386034 4:120066714-120066736 CCATGGCGCTGCAGCTCTCCCGG - Exonic
980261886 4:130459755-130459777 GCCCTGTGCTGCAGGTCTCCTGG + Intergenic
982292154 4:153791059-153791081 GCCCCGCGCTGCCGCACGCCCGG + Intergenic
986152359 5:5139828-5139850 TCCGCGGGCTGCAGGTGTCCCGG + Intergenic
992609866 5:78498014-78498036 CCCGCGTGCTGCTCCTCTCCTGG - Intronic
1002281233 5:178131111-178131133 GCCGCGCGCCTCAGCTCCGCCGG - Intronic
1002541329 5:179908042-179908064 GCCGTGGGCTGCACCGCTCCAGG - Intergenic
1002898183 6:1390956-1390978 GCGGCGCACTGGAGCTCGCCTGG + Exonic
1005149023 6:22726537-22726559 GCTGCGGGCTGCAGCTTTACAGG + Intergenic
1018836304 6:167486776-167486798 GCCGGGGGCTCCAGCTCTCTGGG + Intergenic
1020125971 7:5532645-5532667 GCCCCGGGCTGCAGCATTCCTGG + Intronic
1020430726 7:8113871-8113893 GCCGCCCCCAGCAGCTCCCCTGG - Exonic
1023286986 7:38630988-38631010 GCCCCGGGTTGCCGCTCTCCTGG - Intronic
1025089725 7:56052020-56052042 ACCGCGCGCCGCCGCGCTCCTGG + Intronic
1026131190 7:67622272-67622294 GCCTCTCCCTGCAGCCCTCCTGG + Intergenic
1029188031 7:98753409-98753431 GCCTCGTGCTGGAGGTCTCCCGG + Intergenic
1029485337 7:100836604-100836626 GCCTCGCACTGCTGCCCTCCAGG + Intronic
1029680249 7:102103336-102103358 GCCTGGCCCTGCAGCTCTGCTGG - Intronic
1031096557 7:117427489-117427511 CGCGCGCCCTTCAGCTCTCCGGG + Exonic
1032068801 7:128791524-128791546 GCCGCGGGCTGGAGCTGCCCGGG + Intronic
1037807464 8:22066629-22066651 TCCGCGGGCGGCCGCTCTCCAGG - Intronic
1038945064 8:32350045-32350067 GGCGTGGGCAGCAGCTCTCCTGG + Intronic
1040652486 8:49464890-49464912 ACCGCGCCCTGCAGCTCTCGGGG - Intergenic
1043502813 8:80873870-80873892 GCGGCGGCCTCCAGCTCTCCGGG + Intronic
1045047199 8:98290790-98290812 GCTCCCCGCTGCAGCTCTCTTGG - Intronic
1048893117 8:138965459-138965481 GCAGCCCCATGCAGCTCTCCCGG - Intergenic
1049379263 8:142303884-142303906 GCCTCGTGCTGCATCCCTCCTGG - Intronic
1049415469 8:142492929-142492951 GCCGGCCGCGGCAGCTCTCGGGG + Intronic
1049707252 8:144048647-144048669 GCCGCGCACTCCAGCTGCCCGGG - Intergenic
1049820836 8:144632317-144632339 GGTGGGCTCTGCAGCTCTCCTGG - Intergenic
1057054061 9:91948630-91948652 GCTGCGCGCTCCAGGTATCCTGG - Intronic
1057716946 9:97502556-97502578 AGCGCGCCCTGCAGCTCTCAGGG - Intronic
1060004408 9:119986878-119986900 GCAGCGCCCTGCAGGTCTCGGGG + Intergenic
1060555052 9:124503783-124503805 GCCGGGCGCCCCAGCGCTCCTGG - Intronic
1061477789 9:130880590-130880612 TCTGTGCTCTGCAGCTCTCCTGG - Exonic
1062152835 9:135030742-135030764 GTCGCCCTCTGCGGCTCTCCTGG + Intergenic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062699160 9:137890140-137890162 GCCCCGCGCTGCTTCTATCCAGG - Intronic
1187470334 X:19563895-19563917 GCCGCGCCTTCCAGCTCTCTCGG - Intronic
1200104180 X:153703271-153703293 GCCACCTGCTGCAGCTCGCCGGG + Intronic