ID: 969622461

View in Genome Browser
Species Human (GRCh38)
Location 4:8285597-8285619
Sequence GGTCCCGAAGGTTCCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969622448_969622461 20 Left 969622448 4:8285554-8285576 CCTCAGGGAGTGAGTACCTGCTC 0: 1
1: 0
2: 0
3: 18
4: 167
Right 969622461 4:8285597-8285619 GGTCCCGAAGGTTCCCACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 60
969622453_969622461 4 Left 969622453 4:8285570-8285592 CCTGCTCTGGGCTGGGCCCCACG 0: 1
1: 0
2: 10
3: 41
4: 380
Right 969622461 4:8285597-8285619 GGTCCCGAAGGTTCCCACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969622461 Original CRISPR GGTCCCGAAGGTTCCCACCC TGG Intronic