ID: 969624640

View in Genome Browser
Species Human (GRCh38)
Location 4:8296197-8296219
Sequence CTGTCTCAGGAGAAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 590}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969624640_969624653 18 Left 969624640 4:8296197-8296219 CCTCTCTCTTTCTCCTGAGACAG 0: 1
1: 0
2: 5
3: 52
4: 590
Right 969624653 4:8296238-8296260 GTTTGCTCCTTTGTTGTACAGGG 0: 1
1: 0
2: 1
3: 12
4: 184
969624640_969624646 -4 Left 969624640 4:8296197-8296219 CCTCTCTCTTTCTCCTGAGACAG 0: 1
1: 0
2: 5
3: 52
4: 590
Right 969624646 4:8296216-8296238 ACAGGATCCCCCTGGGGCCTAGG 0: 1
1: 0
2: 2
3: 24
4: 318
969624640_969624652 17 Left 969624640 4:8296197-8296219 CCTCTCTCTTTCTCCTGAGACAG 0: 1
1: 0
2: 5
3: 52
4: 590
Right 969624652 4:8296237-8296259 GGTTTGCTCCTTTGTTGTACAGG 0: 1
1: 0
2: 2
3: 11
4: 155
969624640_969624654 19 Left 969624640 4:8296197-8296219 CCTCTCTCTTTCTCCTGAGACAG 0: 1
1: 0
2: 5
3: 52
4: 590
Right 969624654 4:8296239-8296261 TTTGCTCCTTTGTTGTACAGGGG 0: 1
1: 0
2: 0
3: 18
4: 243
969624640_969624645 -10 Left 969624640 4:8296197-8296219 CCTCTCTCTTTCTCCTGAGACAG 0: 1
1: 0
2: 5
3: 52
4: 590
Right 969624645 4:8296210-8296232 CCTGAGACAGGATCCCCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969624640 Original CRISPR CTGTCTCAGGAGAAAGAGAG AGG (reversed) Intronic
900616994 1:3569946-3569968 TTATCCCAGGAGAAAGACAGAGG + Intronic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901420263 1:9145971-9145993 CTGTCTCAGGAAAAAAAAAAAGG + Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902306762 1:15546307-15546329 CTGTCTCAGAAAAAAGGGTGAGG + Intronic
902557509 1:17255626-17255648 GTGTGTTAGGAGAATGAGAGGGG - Intronic
903351822 1:22721619-22721641 CTGTCTAAGAAAAAAGAGAGAGG - Intronic
903465168 1:23546954-23546976 CTGTCTCAGAAAGAAAAGAGGGG + Intergenic
904551137 1:31319349-31319371 CTGACTCAGGAGGAAGACTGGGG + Intronic
904674703 1:32191805-32191827 CTGTGTCAGGTGAGAGAGAAGGG - Intronic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
905549694 1:38826758-38826780 CAGTCAGAGGAGAAAGAAAGAGG + Intergenic
905567662 1:38978613-38978635 CTGTCACGGGACATAGAGAGGGG + Intergenic
905697280 1:39984224-39984246 CTGTCTCTTAAAAAAGAGAGAGG + Intergenic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
906320820 1:44814300-44814322 CCGTCTCAAAAAAAAGAGAGAGG - Intronic
906407469 1:45553414-45553436 CTGTCTCAAAAAAAAAAGAGTGG + Intronic
906538571 1:46566975-46566997 CTGTCTCTTAAGAAAAAGAGAGG - Intronic
906661865 1:47588610-47588632 CTGTCTCATCTAAAAGAGAGGGG + Intergenic
906777505 1:48543203-48543225 CTGACTCAGGAGTAGGTGAGGGG + Intronic
906863892 1:49394572-49394594 CTTTCTCTGGAGGAAGAGGGGGG - Intronic
907284009 1:53368840-53368862 CTGTGGGAGGAGGAAGAGAGAGG - Intergenic
907863998 1:58381138-58381160 CTGTCTCAGGGGGAAAAGTGGGG + Intronic
909169711 1:72280818-72280840 ATGTCTAAGGTGAAAGAGAGTGG - Intronic
909971283 1:81993459-81993481 CTGCCTCAAGAGAAAGAAATAGG - Intergenic
910440976 1:87251469-87251491 ATATCTCATGAGACAGAGAGAGG - Intergenic
911168283 1:94744633-94744655 CTGGCTCAGGAGAACCAGGGAGG + Intergenic
911965172 1:104359884-104359906 CTCTCTTGGGAGAAAGAGTGAGG + Intergenic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913364636 1:118023489-118023511 CATTCTCAGAAGCAAGAGAGAGG + Intronic
914445353 1:147745623-147745645 CTATCACAGTAGAAAGAAAGCGG + Intergenic
915199738 1:154218439-154218461 CTGCCTCATGAGAAAGACATAGG - Intronic
915499680 1:156306813-156306835 CTGTCTCAGAAAAAAAAAAGAGG + Intergenic
915549581 1:156624507-156624529 CTGTCTCAGGGGCCCGAGAGAGG + Intronic
915783672 1:158583133-158583155 CTTTCTCTGATGAAAGAGAGAGG - Intergenic
915906632 1:159882850-159882872 CTGGCTCAGGGGAGAGAGAGTGG - Intronic
916720109 1:167478442-167478464 CTGTCTCATGGAAAAGAGATTGG + Intronic
917339244 1:173957556-173957578 CTGTCTCAGAAAAATTAGAGGGG - Intronic
917484651 1:175444667-175444689 CTGTCTCATGGGAGAGACAGAGG + Intronic
918052278 1:180984542-180984564 CTGTCTCAAAAAAAAGAGAAAGG + Intronic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919380826 1:196858822-196858844 CTGTCTCTTGTGAGAGAGAGGGG + Intronic
919838762 1:201594327-201594349 ATGACCCAGGAGAAAGGGAGGGG + Intergenic
920089377 1:203441447-203441469 CCGTCTCTGGAGACAGTGAGTGG - Intergenic
921987917 1:221332832-221332854 CTCTCTCTTGCGAAAGAGAGGGG + Intergenic
922534711 1:226371256-226371278 ATGTCTCAGGATACAGAGTGTGG - Intronic
922923556 1:229329204-229329226 CTGGAACAGGAGGAAGAGAGGGG - Intronic
922980725 1:229824417-229824439 CTCTGTCAGAACAAAGAGAGGGG - Intergenic
923045526 1:230352939-230352961 CTTTCTGAAGAGAATGAGAGAGG - Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063616818 10:7607473-7607495 CTGTCTCTACAGAAAGAAAGAGG + Intronic
1063844130 10:10106646-10106668 CTCTCTCAGGAGATAGAGCATGG - Intergenic
1064103946 10:12485489-12485511 CTGTCCCAGGTGGAGGAGAGGGG + Intronic
1064485596 10:15785298-15785320 CTGTTACAGGCGAAAGAGAAGGG + Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065330263 10:24589166-24589188 CTGTCTCATTAGACATAGAGAGG + Intronic
1065784823 10:29203430-29203452 CTGTCTCGAAAGAAAGAGAGAGG + Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1066414040 10:35203057-35203079 CTGTCTCAGGAAAAAAAAAAAGG - Intronic
1067238061 10:44468277-44468299 CCCTATCTGGAGAAAGAGAGAGG + Intergenic
1067369993 10:45673684-45673706 GGGTCTCAGAAGAATGAGAGAGG - Intergenic
1067415150 10:46097071-46097093 CTGTAGCAGGGTAAAGAGAGAGG - Intergenic
1067435185 10:46272120-46272142 CTGTACCAGGGTAAAGAGAGAGG - Intergenic
1067587640 10:47485732-47485754 CTTGCTCATGAGAAGGAGAGAGG + Intergenic
1067809382 10:49415587-49415609 ATGTGTCTGGAGAGAGAGAGAGG + Intergenic
1068285626 10:54930365-54930387 CTGTCTCCTGCGAAAGAGAGGGG - Intronic
1068583050 10:58764669-58764691 TTGTTTTAGGAGAAAGAAAGTGG - Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069437995 10:68403253-68403275 CTGTCTCAAAAGAAAGAAAATGG - Intronic
1069769296 10:70887675-70887697 CCGGCTCTGGAGACAGAGAGGGG + Intronic
1070230461 10:74560847-74560869 CTCTTGCAAGAGAAAGAGAGAGG + Intronic
1071283592 10:84124741-84124763 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
1071418119 10:85459961-85459983 CTCTCTCCCGAGAGAGAGAGGGG - Intergenic
1071961745 10:90813995-90814017 CTCTCTCTTGCGAAAGAGAGGGG - Intronic
1072127367 10:92458800-92458822 CTGTTTCAAAAAAAAGAGAGAGG - Intronic
1073361612 10:102903901-102903923 CTGTCTCAGAAAAAAAAAAGGGG + Intergenic
1074616862 10:115078368-115078390 CTTTCTCATGAAAAAGAAAGAGG - Intergenic
1074807377 10:117067097-117067119 ATGCCTGAGGAGAAAGAGTGTGG + Intronic
1075050237 10:119178188-119178210 ATGACTCAGGAGAACGAAAGGGG + Intronic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075973630 10:126675843-126675865 TTGTCTCAGGGGCAAGGGAGAGG - Intergenic
1076518379 10:131062830-131062852 CTGTCTCAGCAGGAAGAAGGAGG - Intergenic
1076762175 10:132611309-132611331 CTGTCAGAGGAGAATGAGGGAGG + Intronic
1077103569 11:832621-832643 CTGGGTGAGGAGAAAGAGATGGG + Intergenic
1077959548 11:7060183-7060205 TTGTCTCAGGCAGAAGAGAGAGG - Intronic
1078188703 11:9074171-9074193 ATGTCTCAGGAGCAATATAGTGG - Intronic
1078436999 11:11333676-11333698 CTTTCTCAGGAGCATCAGAGAGG + Intronic
1078586245 11:12592170-12592192 CTGTCTCAAGAGAAAATGACTGG - Intergenic
1078971153 11:16413270-16413292 CTGTCTCTGAAGTAAGAGAAGGG - Intronic
1079457718 11:20651276-20651298 CGGTCTCAGGAAAAAGGGAAGGG - Intronic
1079519160 11:21304359-21304381 CTTTCTCAGGAGTCAGAGACAGG + Intronic
1080309970 11:30878447-30878469 CTGTCTCAGAAAAGAAAGAGGGG + Intronic
1080492503 11:32781570-32781592 CTGCCTAACCAGAAAGAGAGAGG - Intronic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1081145132 11:39553930-39553952 CTGTGTCCTGAGAAATAGAGAGG - Intergenic
1081156089 11:39692888-39692910 CTGTCTCAGGAGTAGCAGAAGGG - Intergenic
1081392425 11:42544663-42544685 CTGTCTCAGGAAAAAATTAGAGG + Intergenic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1082170051 11:48992880-48992902 CAGCTTCAGGAGAAAGAAAGAGG - Intergenic
1082607829 11:55263871-55263893 CAGCTTCAGGAGAAAGAAAGAGG + Intronic
1084031665 11:66484825-66484847 CAGGCTCTGGAGAAAGAGGGAGG + Intronic
1086695772 11:89843747-89843769 CAGCTTCAGGAGAAAGAAAGAGG + Intergenic
1086710382 11:90000736-90000758 CAGCTTCAGGAGAAAGAAAGAGG - Intergenic
1087165712 11:95000217-95000239 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1087255978 11:95953854-95953876 CTCTCTCATGAGAAAGAAAGAGG - Intergenic
1088073118 11:105813880-105813902 CTGTCTCATGAGAGAGAGAGTGG + Intronic
1088301900 11:108366990-108367012 CTGTCTCAGAAAAAAATGAGGGG - Exonic
1088700587 11:112407818-112407840 CTGTGTCAGGTGAAATAGACAGG - Intergenic
1088984139 11:114890556-114890578 TAGTCTCAGGAGAAAGAGTTTGG + Intergenic
1088989311 11:114938025-114938047 GTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089474651 11:118749011-118749033 CTTTCACAGAAGTAAGAGAGAGG - Exonic
1090324193 11:125870682-125870704 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
1090325611 11:125883868-125883890 CTGTCTCAAAAAAAAAAGAGTGG + Intronic
1091442214 12:520093-520115 CTGGCTCAGGGAAAAGGGAGTGG + Intronic
1091493535 12:952886-952908 CTGTCTCAAAAGAAAGGGAACGG + Intronic
1093394924 12:18669660-18669682 CTGTCTCAAAAAAAAAAGAGAGG - Intergenic
1094735048 12:33224742-33224764 TTGTTTCAGGGGAAAAAGAGGGG - Intergenic
1095548369 12:43400244-43400266 CTGTCTCAGAGGAATGAGAAAGG - Intronic
1095670355 12:44852489-44852511 CTGTCTCATGAAGAAAAGAGAGG - Intronic
1095927369 12:47592347-47592369 CTGTCTTGAGAGAGAGAGAGAGG + Intergenic
1096026035 12:48362059-48362081 ATTTCTCTGGAGAAGGAGAGGGG - Intergenic
1098452505 12:70635780-70635802 TTGTTTCTGGAGAAAGAGAGAGG + Exonic
1098788555 12:74790913-74790935 CTGTCTCAACAGAAAAACAGTGG + Intergenic
1099288847 12:80749822-80749844 CTGTCTTAGGAGAAAGAAACAGG - Intergenic
1099429619 12:82566807-82566829 CAGGCTCAGGAGCAAGAGTGAGG - Intergenic
1099796083 12:87401495-87401517 CTCTCTCAGGACAAAGAAAAAGG + Intergenic
1100494385 12:95110985-95111007 CTGTCTCAGGAAAAAAAGAGTGG - Intronic
1100877750 12:98980796-98980818 CTGACTCAGAAGACAGAGACTGG - Intronic
1101331529 12:103761499-103761521 CAGTCTCTGGAGGAAGAGGGAGG - Intronic
1101522080 12:105493395-105493417 CTGCCTCCGGAAAAAGTGAGGGG - Intergenic
1101893513 12:108736264-108736286 CTGTCTCATTAAAAAGAGAGAGG + Intergenic
1102022469 12:109693383-109693405 CTGTGGTAGGAGAGAGAGAGAGG + Intergenic
1102519987 12:113472153-113472175 ATTTGTGAGGAGAAAGAGAGAGG - Intronic
1102522225 12:113485529-113485551 CTGGCTCAGGGGAGAGAGGGCGG - Intergenic
1102599258 12:114016662-114016684 CTGTCTCAAAAAAAAGAGGGGGG + Intergenic
1102683136 12:114704052-114704074 TTGTCTGAGAAGAAACAGAGAGG - Intergenic
1103379941 12:120486426-120486448 TTCTCTCAGGGGACAGAGAGGGG - Intronic
1103793842 12:123490116-123490138 CTGTCTGAGGAGGAAGGGACTGG - Intronic
1104005951 12:124892575-124892597 CTATCTCAAGAGAGGGAGAGAGG - Intergenic
1105028190 12:132863762-132863784 CTGTCTCAAAAAAAAGATAGAGG - Intronic
1105492130 13:20899089-20899111 CTGTCTCAAAAGAAAGGGAGGGG + Intronic
1106330203 13:28732856-28732878 CTGTCTCAAAAAAAAGAGAGAGG + Intergenic
1106480390 13:30133187-30133209 CTGGCTCTGGGGAAAGAGGGTGG - Intergenic
1107262196 13:38506312-38506334 CTGGATCAGGAACAAGAGAGAGG - Intergenic
1107626554 13:42291861-42291883 CTGTCTGATGAAAATGAGAGGGG - Intronic
1108014886 13:46064253-46064275 CTGTCTCAAAAAAAAAAGAGAGG + Intronic
1108809296 13:54201590-54201612 CTGAATCAGGAGCAAAAGAGAGG - Intergenic
1109085746 13:57969177-57969199 CTGTCTCATTAAAAAAAGAGAGG + Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109285000 13:60398269-60398291 CTGCTTTAGGAGAAAGAGTGAGG + Intronic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1109930082 13:69205206-69205228 CTGTTGGAGGAGAGAGAGAGAGG + Intergenic
1110550041 13:76801755-76801777 CTGTCTCAGAAGAAAAAAAATGG + Intergenic
1110726898 13:78836488-78836510 CTCTTTCAGCAGAAAGAGTGAGG + Intergenic
1110908701 13:80926487-80926509 CTGTCTCAGTAGTAAGAAAGGGG + Intergenic
1111020020 13:82437329-82437351 GTGGATCAGGAGAGAGAGAGTGG - Intergenic
1111067614 13:83117137-83117159 TTGTCTCAGGAGAAGGACAAAGG - Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1112253928 13:97810527-97810549 CTGTTTTTAGAGAAAGAGAGGGG - Intergenic
1112630485 13:101156395-101156417 CTCCCTCAGCAGAAAGAGCGGGG + Intronic
1113052502 13:106229524-106229546 CTGTCTCTGGAGATAGAGCTGGG - Intergenic
1113060813 13:106320818-106320840 CTGTCTCAAGAGAAAAAAAAAGG + Intergenic
1113524858 13:110966854-110966876 CTGTCTGAGGGGAAAGACTGAGG - Intergenic
1113883882 13:113647237-113647259 CTGCCTCTGAAGAAAGAGTGGGG + Intergenic
1114722393 14:24896481-24896503 GAGTCTCTTGAGAAAGAGAGAGG + Intronic
1115732934 14:36291146-36291168 CTGTCTCAATAGAAAGACAAGGG - Intergenic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1117871425 14:60205061-60205083 GTATCTCAGGTGACAGAGAGTGG + Intergenic
1118242565 14:64074238-64074260 CGGTCTGGGGAGAGAGAGAGAGG + Intronic
1118645603 14:67835849-67835871 CTGTCTCAAAAAAAAGAAAGTGG + Intronic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1118909385 14:70048753-70048775 CTGTCCCAGGTGAGAGTGAGAGG - Exonic
1119225975 14:72944785-72944807 CTGTCTCAAGAGAAAAAAATAGG + Intronic
1119681686 14:76597051-76597073 CTGGTGCAGGAGGAAGAGAGAGG + Intergenic
1120438668 14:84509272-84509294 CTGTCTCGAAAGAAAGAGAAAGG + Intergenic
1122233304 14:100318102-100318124 CTGTCTCAAAAAAAAGAAAGAGG + Intergenic
1122642275 14:103166986-103167008 GAGGCTCAGGAGAGAGAGAGAGG + Intergenic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1123489174 15:20766073-20766095 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1123545673 15:21335160-21335182 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1123569868 15:21592657-21592679 CTGACTTGGGAGAAAGGGAGAGG + Intergenic
1123605979 15:22027976-22027998 CTGACTTGGGAGAAAGGGAGAGG + Intergenic
1123668872 15:22633511-22633533 CTTTTTAAAGAGAAAGAGAGAGG + Intergenic
1124232640 15:27958516-27958538 CTGACACAGGCGAAAGAGAGAGG + Intronic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125300540 15:38250604-38250626 CTTACTCTTGAGAAAGAGAGGGG - Intergenic
1125398719 15:39277287-39277309 CGGTCTCAGAAGAAAGTGATAGG + Intergenic
1125402938 15:39323524-39323546 CATTCTCAGGAGAAAGAAAGGGG + Intergenic
1126639168 15:50807307-50807329 CTGTCTCGAAAGAGAGAGAGAGG - Intergenic
1126764422 15:51998524-51998546 CTGCCTCAAAAAAAAGAGAGAGG - Intronic
1128067947 15:64775817-64775839 CTGACCCAGGCGAGAGAGAGGGG - Intergenic
1128556963 15:68638289-68638311 CCCTCACAGGAGAAGGAGAGAGG + Intronic
1128561354 15:68670050-68670072 CTGTCTCAGAAAAAAAAAAGGGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128704985 15:69832195-69832217 CTGTTTCAGGAGAAAGGCAGGGG + Intergenic
1128769079 15:70268492-70268514 GGGTCTCAGGACAAGGAGAGTGG - Intergenic
1129529447 15:76251622-76251644 CTGTCTCAGGAAAATGAGAAAGG + Intronic
1130081187 15:80735102-80735124 CTGTGGCAGGAGAAAGAATGAGG + Intronic
1130214649 15:81956867-81956889 CTGTCTCATGAGGATGAGACAGG - Intergenic
1130610350 15:85355228-85355250 CTGTCTCAAAAGAAAGAAAAAGG - Intergenic
1130615732 15:85405849-85405871 CTGTCTCAAAAAAAAGAGGGTGG - Intronic
1131091083 15:89625362-89625384 CTGGCCCAGGAGGAAGAGGGCGG + Exonic
1202954017 15_KI270727v1_random:62430-62452 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1202978217 15_KI270727v1_random:319749-319771 CTGACTTGGGAGAAAGGGAGAGG + Intergenic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1132996412 16:2825753-2825775 CTGCCTCAGGAGAGAGTCAGGGG + Intronic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133414695 16:5597296-5597318 CTGTCTCAAAAGAGAGAGGGCGG - Intergenic
1133671253 16:8023125-8023147 AAGTCTTAGGAGAAAGAGTGTGG - Intergenic
1133747701 16:8699829-8699851 CTGTCTCAAAAGAAAGAAAGAGG - Intronic
1134173117 16:11984656-11984678 CTGTCTCAAAAGAAAAAGAGAGG - Intronic
1134747524 16:16599610-16599632 CTGTCTCAGAAAAAAGAAAATGG - Intergenic
1134997946 16:18754047-18754069 CTGTCTCAGAAAAAAGAAAATGG + Intergenic
1135109573 16:19680350-19680372 CTGTCCCAGGAGCCAGAGACAGG + Intronic
1135271500 16:21073650-21073672 CTGTCTTAGGGGAAAGATAAAGG - Intronic
1135999225 16:27278309-27278331 CTGCCTCAAAAGAAAAAGAGAGG + Intronic
1136708847 16:32216169-32216191 CTGTCTCAAAAGAAAAAAAGTGG + Intergenic
1136759061 16:32713239-32713261 CTGTCTCAAAAGAAAAAAAGTGG - Intergenic
1136809046 16:33157147-33157169 CTGTCTCAAAAGAAAAAAAGTGG + Intergenic
1136815522 16:33267227-33267249 CTGTCTCAAAAGAAAAAAAGTGG + Intronic
1137485732 16:48889184-48889206 CTATCTTAGGATAAAGAGAGGGG - Intergenic
1137571312 16:49568063-49568085 ATGTCTCTGGATAAAGAGACTGG + Intronic
1137591080 16:49694363-49694385 CTGTGCCAAGAGAAACAGAGAGG + Intronic
1138499436 16:57430086-57430108 CTGTCTCCTGAGAGTGAGAGTGG - Intronic
1138559892 16:57795142-57795164 CTGTCCCAGGACAGAGAGATAGG + Intronic
1138682346 16:58694505-58694527 CTGTCTCAAGAGAGCGAGAAGGG - Intergenic
1138746409 16:59367791-59367813 CTGTCTCTGTCGCAAGAGAGAGG - Intergenic
1138845679 16:60562945-60562967 CTGTCTCAGAAGGATGAAAGGGG - Intergenic
1138930391 16:61647827-61647849 CTGTCTGAAGAGAAAGACTGTGG - Exonic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1140857355 16:78989768-78989790 CTGGCCCAGGAGGAAGTGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141362405 16:83408122-83408144 ATGTGTCAGGAGAATGAGACCGG - Intronic
1141780684 16:86158484-86158506 CTGTTTCAGGTGACAGTGAGTGG - Intergenic
1142246853 16:88974150-88974172 CTGCCTCAGGAGAGAGGGATGGG - Intronic
1203061218 16_KI270728v1_random:973553-973575 CTGTCTCAAAAGAAAAAAAGTGG - Intergenic
1143128734 17:4662522-4662544 CAGTCTCCCGAGAAAGAGAAAGG - Intergenic
1143546149 17:7597092-7597114 CTGTCTCAAAAAAAAGTGAGGGG + Intronic
1143582741 17:7836064-7836086 CTTTCCCAAGAGAAAGCGAGCGG + Intergenic
1143968484 17:10774603-10774625 CTGTCTCAAGAAAAAGAAAGAGG - Intergenic
1144556920 17:16290395-16290417 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144822697 17:18086680-18086702 CTGTCTCAAGAAAAAAAAAGTGG - Intergenic
1145823226 17:27856737-27856759 CTGTGTCAGGAATCAGAGAGTGG - Intronic
1146154172 17:30506089-30506111 CTGTGTCAGGTAATAGAGAGGGG - Intronic
1146254353 17:31381348-31381370 CTGTCACAGAAGCAAGAGAAGGG - Intronic
1146699975 17:34949028-34949050 CTGTCTCAGAAAAAAAAGAAAGG + Intronic
1146841178 17:36155362-36155384 CTGTCTCAGGGGAAAAAAAAGGG + Intergenic
1146853418 17:36242993-36243015 CTGTCTCAGGGGAAAAAAAAGGG + Intronic
1146869328 17:36366885-36366907 CTGTCTCAGGGGAAAAAAAAGGG + Intronic
1147072202 17:37967509-37967531 CTGTCTCAGGGGAAAAAAAAGGG + Intergenic
1147083727 17:38047046-38047068 CTGTCTCAGGGGAAAAAAAAGGG + Intronic
1147099673 17:38171013-38171035 CTGTCTCAGGGGAAAAAAAAGGG + Intergenic
1147855224 17:43474761-43474783 TTGTATCAGGAAAAAGAGAAGGG + Intergenic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1148128817 17:45250506-45250528 CTGCCCCAGGAGAAAGAAAGAGG + Intergenic
1148385347 17:47230564-47230586 ATGTCTAAGGAGCAAGGGAGAGG + Intergenic
1150082680 17:62254307-62254329 CTGTCTCAGGGAAAAAAAAGGGG + Intergenic
1150305784 17:64084164-64084186 CAGTCTCAGGCAAAAGACAGAGG - Intronic
1150689598 17:67353319-67353341 CTGTCTCAAAAGAAAGAGAGAGG - Intronic
1150830003 17:68511357-68511379 CTGTCTAAGGAGGAAGAAAAGGG - Intergenic
1151295698 17:73184665-73184687 CTGTCTCAAGAGAAAAAAAAAGG + Intergenic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152865164 17:82718000-82718022 GTGTCTCAGGAGAAAAAGAAAGG + Intronic
1153286746 18:3463634-3463656 CTGTCTCAGGAAAAAAAAAAAGG - Intergenic
1153580233 18:6565600-6565622 CTGTCTCAAAAAAAAGAGAAAGG + Intronic
1155213387 18:23621330-23621352 CTGTCCCAGGAAAGGGAGAGAGG + Intronic
1155588127 18:27391974-27391996 GTGTGCCAAGAGAAAGAGAGAGG + Intergenic
1155699344 18:28724080-28724102 TTGTCTCAAAAGAAAGAAAGGGG - Intergenic
1156717255 18:40026138-40026160 CTGTGTGTGAAGAAAGAGAGGGG + Intergenic
1157903264 18:51541524-51541546 CTGTCATAGGAGAGAGAGAGAGG + Intergenic
1160068501 18:75602321-75602343 CTGACTAAGCAAAAAGAGAGAGG + Intergenic
1160181300 18:76638811-76638833 CTGCCTCAGGAGAGAGGAAGTGG - Intergenic
1160435922 18:78852763-78852785 CTGTCACAGGAGCCAGAGAAAGG - Intergenic
1160843831 19:1158031-1158053 CGGACTCAGGAGAGAGAGACGGG - Intronic
1161828666 19:6586789-6586811 CTGTCTCAAAAAAAAGGGAGGGG + Intronic
1162268516 19:9595490-9595512 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
1162382344 19:10339027-10339049 CTGTCTCGGCACAAGGAGAGAGG - Intronic
1162551142 19:11359049-11359071 CTGTCTCAGAAAAAAAAGAAAGG - Intronic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1163541147 19:17911358-17911380 CGGTCTCCAGAGAAAGAGGGTGG + Intergenic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164497590 19:28782155-28782177 CTGTCTCATCAGAATGACAGTGG - Intergenic
1164616132 19:29667713-29667735 CTGTGTCCGGAGTAGGAGAGAGG + Intronic
1166415037 19:42589172-42589194 CTGTCTCAGTAGAAACAGCGGGG - Intronic
1166523988 19:43499536-43499558 CTGTCTCAGGAGAGAGGGCCTGG + Intronic
1166853522 19:45771321-45771343 CTGAGGCAGGGGAAAGAGAGGGG + Intronic
1167422500 19:49412519-49412541 ATGTCTCTGGAGAAACCGAGAGG + Intronic
1167886306 19:52502730-52502752 CTGTCTCAAAAGAAAAAGAGAGG + Intronic
1167903051 19:52636658-52636680 CTGTCTCAAAAGAAAAAAAGGGG - Exonic
1167940237 19:52940954-52940976 CTGTCTCAAAAGAAAAAAAGGGG - Intronic
1168030952 19:53679280-53679302 CTGTCTCAAGAGAAAAAAAAGGG - Intergenic
1168142360 19:54397054-54397076 CTGTCTCAGAAAAAAAAGTGAGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926245594 2:11120666-11120688 CTGTCTCAAGAGAAATGGACAGG + Intergenic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
927796388 2:26052541-26052563 CTTTCTCTGGAGAAACAGAATGG - Intronic
928489532 2:31767164-31767186 CTGTTTCAGGATTTAGAGAGTGG - Intergenic
928686226 2:33752572-33752594 GTATCACAGGAGAAAGAGAATGG - Intergenic
928868964 2:35952099-35952121 CTGTCATAGGCGAAAGAGAAAGG - Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
929956883 2:46464881-46464903 CTGGCTCAGCTGAAAGATAGCGG - Intronic
929957049 2:46466055-46466077 CTGGCTCAGCTGAAAGATAGCGG + Intronic
930505465 2:52278162-52278184 CTATCTGAGGAGAAAGAGAAGGG - Intergenic
930525264 2:52521097-52521119 CTGTCCCAGGAGAATGATCGAGG + Intergenic
930635586 2:53802144-53802166 ATGTATCAGGAGACAGAGATAGG - Intronic
930650459 2:53959358-53959380 CTGTCTCAAAAAAAAGAGGGGGG + Intronic
930750145 2:54926601-54926623 CTGTCTCAAGAGAAAGACACTGG - Intronic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
931292657 2:60889244-60889266 CTGTGTCAGTGGAAAAAGAGCGG - Intronic
931563587 2:63589765-63589787 TTGTCTCTGCTGAAAGAGAGGGG + Intronic
931836267 2:66101043-66101065 CTGTCTCAAAAAAAAAAGAGAGG + Intergenic
932587630 2:73041705-73041727 TTGTCTCAGGAAAAAGAGAAAGG - Intronic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
932812652 2:74837286-74837308 CTGTCTCTGGGGAATGTGAGCGG + Intronic
932928753 2:76008353-76008375 CTCTCTCTTGTGAAAGAGAGGGG - Intergenic
933390121 2:81657103-81657125 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
933466092 2:82654214-82654236 CAGTTTCATGAGAAAGAGAGAGG - Intergenic
934027356 2:88012367-88012389 CTGTCTCAAAAAAAAGAGAGAGG + Intergenic
934566078 2:95342155-95342177 CAGCCACACGAGAAAGAGAGAGG + Intronic
934757735 2:96836086-96836108 CTGTCTCAGGAAAAAAAAAAGGG - Intronic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935047881 2:99498277-99498299 CTGTCTGAGGGGAAAGATTGGGG - Intergenic
935155396 2:100479741-100479763 TCGTGTCAGGAGAAAGAGACAGG - Intronic
935600061 2:104913412-104913434 CTTTCTCAGGTGAAAGGCAGAGG + Intergenic
938667982 2:133558917-133558939 CTGTCTTAGGGCAATGAGAGAGG - Intronic
939195113 2:138962184-138962206 CTGTCTTAGGATTCAGAGAGAGG - Intergenic
939211682 2:139183611-139183633 CTGTCTAAAAAGACAGAGAGAGG - Intergenic
939223706 2:139337932-139337954 CTATCTCAGGAGAAGGAAGGTGG + Intergenic
940127355 2:150341542-150341564 CTGGAACAGGAGGAAGAGAGAGG - Intergenic
942400423 2:175595725-175595747 TTGTCTCAGGAGAGTGAGACTGG + Intergenic
942925398 2:181426094-181426116 CTGCCTCAGAAGAAAGAGTTTGG - Intergenic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
943713563 2:191125208-191125230 CTGCCTCAGTAGAAAGATACGGG - Intronic
944180729 2:196889936-196889958 CTGTCTCAGAAGAAAAAAAAGGG - Intronic
944705857 2:202287806-202287828 CTGTCTGTTGAGAAAGAGAAAGG + Intronic
944740681 2:202609165-202609187 CTGTCTCAAAAAAAAAAGAGGGG + Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
945100315 2:206257189-206257211 CTGTCTCAGGAGCAAATTAGAGG - Intergenic
945283563 2:208060313-208060335 CTGTCTCAAAAGAAAAAGGGGGG - Intergenic
945782447 2:214192464-214192486 CTGTCTCAGGAGCAAAATTGAGG + Intronic
945911022 2:215649390-215649412 GTCTCTAAGGAGGAAGAGAGAGG + Intergenic
946847267 2:223870336-223870358 CTGGCACGGGAGAAAGACAGAGG - Intronic
946871914 2:224092305-224092327 CTGGCTCAGGGAGAAGAGAGAGG + Intergenic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
947186894 2:227463543-227463565 CTGGTTCAGGGGAAAGAAAGAGG - Intergenic
1168803273 20:657608-657630 CTGTCTCAAAAGAAAGAAAAAGG - Intronic
1169021322 20:2333218-2333240 CTGTCTCCAGAGAAACTGAGAGG + Intronic
1169498321 20:6135342-6135364 CTGTCACAGGAGAGAGAAATGGG + Intergenic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1169792166 20:9422803-9422825 CTGCATAAGGAGCAAGAGAGAGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1171487782 20:25496525-25496547 CTGACTCAGGTGAAATAGGGGGG + Intronic
1172008030 20:31830800-31830822 CTGGCTGAGGAGAAAGGGGGTGG - Exonic
1172164538 20:32891062-32891084 CTGTCTGAGGATAAAGGGTGAGG - Intronic
1172638622 20:36427176-36427198 CTGTCTCAAAAGAAAGAAAGAGG + Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174269316 20:49355779-49355801 CTGTCTCAGAAAAAAAAGGGGGG - Intergenic
1174622267 20:51884882-51884904 ATGTCTTAGGAACAAGAGAGAGG - Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175333716 20:58181455-58181477 ATGACACAGGAGAGAGAGAGCGG + Intergenic
1175420052 20:58825989-58826011 CAAGCTCAGGAGAAAGAGAATGG - Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1175786829 20:61717209-61717231 CTGTCACAGGACAAAGGCAGGGG + Intronic
1175815811 20:61882729-61882751 GCGTCTCAGGAGAATGGGAGAGG + Intronic
1177223238 21:18220732-18220754 ATATCTCAGCAGAAAGAGAATGG - Intronic
1177319445 21:19501138-19501160 CTGGCAAAGGAGAAAGAGAGAGG + Intergenic
1177613523 21:23486692-23486714 CTCACTGAGGAGAAAGAGATGGG + Intergenic
1178016697 21:28355055-28355077 CTGTACTAGGAGAGAGAGAGGGG + Intergenic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1179165481 21:38932228-38932250 GTTTCTCAGGAGACAGAGATGGG - Intergenic
1180175079 21:46083352-46083374 CTGACTCGGGAGAAATTGAGGGG + Intergenic
1180234611 21:46450270-46450292 CTGTATTAGGAGGCAGAGAGAGG - Intergenic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1180719518 22:17896982-17897004 CTGTCTCCAGAGAAAGAGGAGGG + Intronic
1180725871 22:17946147-17946169 CTGTCTCAGGGAACAGAGACAGG + Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183151460 22:36041028-36041050 CAGACACAGGAGACAGAGAGAGG + Intergenic
1183478046 22:38046703-38046725 CCCTCTCAGGGGACAGAGAGTGG - Intergenic
1183524572 22:38315872-38315894 CTGTCTGCAGAGAACGAGAGCGG + Intronic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
1185216674 22:49603870-49603892 CTGTCTCAGGAGAAAAAAAAAGG + Intronic
949160272 3:873769-873791 CTGTCTCAGGATAAAGATCTTGG + Intergenic
949791617 3:7798665-7798687 CTGTTTCAGGGGAACGTGAGAGG + Intergenic
950846782 3:16022757-16022779 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
950955586 3:17050150-17050172 CTGTATAAGGAGAGAGATAGGGG - Intronic
951787852 3:26442757-26442779 CTGTCTCAAAAGAAAAATAGAGG - Intergenic
953615600 3:44488133-44488155 CTGTCTCAGAAAAAAAAGAATGG + Intergenic
954321793 3:49837141-49837163 CAGTCACAGGAGAAAGGTAGAGG + Intronic
954366055 3:50146793-50146815 CTGTCTCAGGAGAGTGGGGGAGG + Intergenic
954559925 3:51548191-51548213 CTGTCTCAAAAAAAAGAAAGTGG - Intronic
955114881 3:55988076-55988098 GTGACTTAGGGGAAAGAGAGAGG - Intronic
955930090 3:64047760-64047782 CTGCCTAAAGAAAAAGAGAGAGG + Intergenic
956592828 3:70933366-70933388 CTGGCTCAGGTGAATCAGAGAGG - Intergenic
956605834 3:71072073-71072095 CTGACTCAGGAGGCCGAGAGAGG + Intronic
957716717 3:83937582-83937604 CTGTGTCAGGAAACAGAGACAGG + Intergenic
957889153 3:86332653-86332675 CTGAGTCAGGAGTATGAGAGTGG + Intergenic
959088828 3:101880772-101880794 CTGTCTCAAAAAAAAGAGATGGG - Intergenic
959855829 3:111156764-111156786 ATGTCTGTGGGGAAAGAGAGAGG - Intronic
960462336 3:117951817-117951839 CTGGATCAGGAGGAAGACAGCGG - Intergenic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
962281553 3:134055825-134055847 CTGTCTCAGGTTTTAGAGAGTGG - Intergenic
962475080 3:135748261-135748283 CCGTCTCAGAAAAAAAAGAGTGG + Intergenic
962840844 3:139230973-139230995 CTGTCCCAGGACACAGAGACAGG + Intronic
964440882 3:156707840-156707862 CTGTCTCAAGAAAAAAAAAGTGG + Intergenic
965492028 3:169349371-169349393 ATGTTCCTGGAGAAAGAGAGGGG - Intronic
965746215 3:171928886-171928908 CTGTCTCAGGAAAAAAAAGGGGG + Intronic
965830842 3:172787355-172787377 CTGTCTCAAGAGAATGAGAGAGG - Intronic
966828130 3:183982674-183982696 TTGTCTCAGGAGGAAGATAAAGG + Intronic
967229178 3:187321358-187321380 TTTTCTCAGAAGCAAGAGAGAGG - Intergenic
967521087 3:190433927-190433949 CTGGGCCAGGAGGAAGAGAGTGG - Intronic
967836022 3:193963524-193963546 CCCTCTTACGAGAAAGAGAGGGG + Intergenic
968125725 3:196158830-196158852 CTGTCTCAGAAAAAAAAAAGAGG - Intergenic
968448173 4:662996-663018 CTGTCTCAAAAAAAAGAAAGTGG + Intronic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969498165 4:7537979-7538001 CTGTCTCAAAAGAAAGAAAAGGG + Intronic
969570642 4:8006279-8006301 GTGGCTCAGGACTAAGAGAGGGG - Intronic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
970355326 4:15245453-15245475 CTGACTCAAGCGAAGGAGAGAGG + Intergenic
970947527 4:21712616-21712638 CTGTCTCAGGAGAAAGGTGTGGG - Intronic
971264979 4:25089327-25089349 CTGGCTCAGGAGGTGGAGAGAGG - Intergenic
971725312 4:30304187-30304209 TTGGAGCAGGAGAAAGAGAGAGG + Intergenic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
973267574 4:48226416-48226438 CTGTCTCAGGGGTGACAGAGGGG - Intronic
973846854 4:54921574-54921596 CTGGAGCAGGAGCAAGAGAGAGG - Intergenic
974841235 4:67301712-67301734 CTGTATCAGGAAGAAGAGACTGG - Intergenic
975372070 4:73600472-73600494 CTGTCTCATAAGAAAATGAGAGG + Intronic
975617915 4:76265758-76265780 CTCTCAGAGGGGAAAGAGAGGGG + Intronic
975854107 4:78604752-78604774 CTGTCTCATGTAAAACAGAGAGG - Intronic
977263560 4:94827226-94827248 CTGTCTCAAGTCAAAGACAGAGG - Intronic
977347126 4:95830204-95830226 CATTCTCAAGAGGAAGAGAGAGG - Intergenic
977810819 4:101353749-101353771 CTCTCTCAGGAGAAAAAAAAGGG + Intergenic
978094500 4:104759041-104759063 CTGTTTCAGGAGAAAAACAAAGG - Intergenic
978492586 4:109324433-109324455 TGGTGGCAGGAGAAAGAGAGGGG + Intergenic
978900801 4:113947473-113947495 CTGTTTCAAAAGAAAGAAAGAGG + Intronic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
979447375 4:120830356-120830378 CTGGCAGAGGGGAAAGAGAGCGG - Intronic
979573510 4:122258087-122258109 CTGTGTCAGAATAAAGATAGTGG + Intronic
980393503 4:132176676-132176698 CTGTCTCAGAGGAAAAATAGAGG - Intergenic
980888899 4:138793224-138793246 CTGCAGCAGGAGGAAGAGAGAGG - Intergenic
982602174 4:157466058-157466080 CTGTCACAGGAAAAAAAGAATGG + Intergenic
983138827 4:164122648-164122670 CTCTCTCTAGAGAGAGAGAGGGG - Intronic
984022087 4:174497951-174497973 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
984181443 4:176487647-176487669 CTGTCTCAGAAAAAAAAGAAAGG + Intergenic
985296194 4:188439608-188439630 CTGTCTCAAAAAAAAAAGAGTGG + Intergenic
986069477 5:4268190-4268212 GGGTCACAGGAGAAAGAGGGTGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986581328 5:9269370-9269392 CTGACTCAGTAGAAAGACAATGG + Intronic
986617283 5:9631242-9631264 CTGTCTCTAAAGAGAGAGAGAGG - Intronic
987101516 5:14595189-14595211 CTGCTTCAGGAGAAAGTCAGTGG + Intronic
988455214 5:31381538-31381560 CTCTCTGAGGAGACAGAGGGGGG + Intergenic
988531309 5:32029680-32029702 GTGTCTCAGGAGGAAGGGACAGG - Intronic
989615705 5:43335056-43335078 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
990319159 5:54612791-54612813 CTGACTCAGGAGACAGTGACAGG + Intergenic
990682573 5:58261790-58261812 CTATCTCAGGATAGAGAGAATGG - Intergenic
990934420 5:61132481-61132503 TGGTGTCAGGAGAAAAAGAGAGG - Intronic
991509512 5:67361234-67361256 CTTTCTCAAGAGAAGGAGTGAGG - Intergenic
991592334 5:68266029-68266051 CTGACCAAGGAGAAAGTGAGTGG - Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993560799 5:89405050-89405072 CTCTCTGGGGAGAAAGAGAAAGG - Intergenic
994057017 5:95428419-95428441 CTCTCTCATCAGAAAGAGAAGGG + Intronic
994296992 5:98102425-98102447 ATGTCACAGCAGAAATAGAGGGG - Intergenic
994760282 5:103843455-103843477 TTTTCTCAGGAGAAAGAGTTTGG + Intergenic
996210501 5:120802828-120802850 CAGTCTGAGGAGAAACAGTGTGG - Intergenic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996315812 5:122159521-122159543 CTATCGGATGAGAAAGAGAGAGG + Intronic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996777392 5:127147428-127147450 CAGGCACAGGAGAGAGAGAGGGG + Intergenic
997032293 5:130144988-130145010 CTGGTGCAGGAGGAAGAGAGAGG + Intronic
997200713 5:132008556-132008578 CTGAGTCAAGAGGAAGAGAGTGG - Intronic
997325623 5:133018402-133018424 CCGTCTCAAAAAAAAGAGAGAGG - Intronic
998142066 5:139705660-139705682 TTGTCTGGGGGGAAAGAGAGGGG - Intergenic
998165015 5:139837848-139837870 CTGACTCACGGGAAGGAGAGGGG - Intronic
998174519 5:139893705-139893727 TTGTCCCAGGAGGAAGAGAATGG - Intronic
998374830 5:141683270-141683292 CTGCCTCAGGGGAAGAAGAGGGG + Intergenic
998580956 5:143375100-143375122 CTTTCTCAGCCGAAAGAGTGAGG - Intronic
999024665 5:148214438-148214460 TTTTCTCAGGAGAAAGTCAGTGG + Intronic
999530531 5:152458177-152458199 CCCTCTCAGCAGACAGAGAGAGG + Intergenic
999533796 5:152493874-152493896 CTGGGGCAGGAGGAAGAGAGAGG + Intergenic
999641702 5:153679239-153679261 GTGTCTATGGAGAAAAAGAGAGG + Intronic
1001175962 5:169469148-169469170 CTCTGTCAGCACAAAGAGAGTGG + Intergenic
1001829385 5:174772995-174773017 GTGACTCAGGAGAAAGGGAGAGG + Intergenic
1003128357 6:3374099-3374121 CTCTCTCTGGACATAGAGAGAGG + Intronic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1003850669 6:10219175-10219197 CTCCCTCAGGACAAAGAGAGGGG - Intergenic
1004239970 6:13912189-13912211 GTGTCTAAGGAGGAAGGGAGTGG + Intergenic
1004399558 6:15275770-15275792 CTGTCCCAAGAGAAGGAAAGGGG - Intronic
1005526243 6:26652878-26652900 ATGTGTCAGGGTAAAGAGAGTGG + Intronic
1005986772 6:30880879-30880901 CTGGCTGTGGAGAAAGGGAGGGG - Intronic
1006112463 6:31756638-31756660 CTGTCTCAAAAAAAAAAGAGTGG - Intronic
1006661168 6:35646109-35646131 CTTTCTCAAAAAAAAGAGAGAGG + Intronic
1007342357 6:41199599-41199621 GTGACTCAGGGGACAGAGAGAGG + Intronic
1007348133 6:41248512-41248534 GTGACTCAGGGGACAGAGAGAGG - Intergenic
1007592205 6:43028946-43028968 CCGTCTCAGAAAAAAGATAGAGG + Intronic
1008115813 6:47548658-47548680 CTGTTTCACAAGATAGAGAGAGG + Intronic
1008928471 6:56912076-56912098 CTGTCTTGGGAGAAAGAGCCTGG - Intronic
1009285792 6:61815248-61815270 ATGTCCCAGGAGGAACAGAGTGG + Intronic
1009342094 6:62568673-62568695 CAGTGGCAGGAGGAAGAGAGAGG - Intergenic
1009380552 6:63023521-63023543 AAGACTCAGGAGAAAGAGAGAGG - Intergenic
1009755770 6:67938169-67938191 CTGTGTCAGAAGAAAGCAAGTGG - Intergenic
1010982311 6:82382106-82382128 CTGTCTCAAAAAAAAAAGAGGGG - Intergenic
1011644789 6:89447248-89447270 CTGTCTCAAAAAAAAGGGAGGGG + Intronic
1012302378 6:97605566-97605588 CTGACACAGTAGAAAGGGAGAGG + Intergenic
1012674780 6:102101686-102101708 CTAGAGCAGGAGAAAGAGAGAGG + Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1012903580 6:105037515-105037537 CTGTCTCAAAAAAAAAAGAGAGG - Intronic
1013124585 6:107170618-107170640 CTGTCTCAGAAAAAAAAAAGTGG - Intronic
1013779517 6:113714531-113714553 CTGAATCCGGAGGAAGAGAGTGG - Intergenic
1014824911 6:126038417-126038439 TTGCCTCAGGGCAAAGAGAGTGG - Intronic
1015209744 6:130683599-130683621 CTGTCTCTGGAAAAAGACAGGGG - Intergenic
1016196326 6:141347027-141347049 CTGTCTCATAACAGAGAGAGAGG - Intergenic
1017219130 6:151945331-151945353 GTGTTTTAGGAGAAAGAGAAAGG + Intronic
1017989316 6:159472396-159472418 CTGGATCAGGAGGAAGAGAGAGG + Intergenic
1018066942 6:160131162-160131184 CTGCCGCAGGAGACAGGGAGAGG + Intronic
1018066975 6:160131312-160131334 CTGCCCCAGGAGACAGGGAGAGG + Intronic
1018066986 6:160131350-160131372 CTGCCCCAGGAGACAGGGAGAGG + Intronic
1018362155 6:163081749-163081771 CTGTCTCAGAAAAAAAAGTGGGG + Intronic
1019539817 7:1546564-1546586 CTGGTTCAGGAGACAGACAGCGG - Exonic
1019658085 7:2208655-2208677 CTGTTTCAGTAGAATGAAAGGGG - Intronic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1020485321 7:8714171-8714193 CTCTCCCAGGAGAAAGGGAAGGG - Intronic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1020886285 7:13822639-13822661 CTACCACAGGAGAAAGACAGAGG - Intergenic
1022314301 7:29230343-29230365 CTGTCTCAAAAAAAAGAAAGAGG - Intronic
1023098470 7:36687995-36688017 CTCTCTCTGGACAAAGAGAAAGG + Intronic
1023798273 7:43811680-43811702 CTGTCTGAGGGGAAAGATTGGGG - Intergenic
1023798765 7:43814987-43815009 CTGTCTGAGGGGAAAGACTGGGG - Intergenic
1023872233 7:44269416-44269438 TTGGCTCTGGAGAAAGAAAGAGG - Intronic
1024024036 7:45396316-45396338 CTGGGTGAGGAGCAAGAGAGAGG - Intergenic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024541798 7:50480725-50480747 CTGTCCCTGGAAAGAGAGAGAGG - Intronic
1025092456 7:56075091-56075113 CTGTCTCAAAAGAAAAAGCGGGG + Intronic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026183209 7:68060525-68060547 CTTTCTCCAGAAAAAGAGAGAGG + Intergenic
1026517633 7:71086673-71086695 CTCTCTAGTGAGAAAGAGAGGGG + Intergenic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1027197312 7:76039560-76039582 CTGGCACAGAAGAAAGAAAGAGG + Intronic
1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG + Intronic
1028333638 7:89625630-89625652 CTGTCTGAGGGGAAAGATTGGGG - Intergenic
1028672624 7:93420634-93420656 CTTTTTTAGGAGAAAGACAGAGG - Intergenic
1028714982 7:93955437-93955459 CAGTCTCAGGAGGACGAGAAGGG + Intergenic
1028952603 7:96653825-96653847 CTCTTTCAGAAGAAAAAGAGAGG - Intronic
1028984656 7:97000172-97000194 GTTTTTCATGAGAAAGAGAGAGG - Intergenic
1029426148 7:100495111-100495133 CTGTTGAAGGAGTAAGAGAGGGG + Intergenic
1029813203 7:103069523-103069545 CAGTCTGAGGAGACAGAGACTGG + Intronic
1030159468 7:106492717-106492739 CCGTCTCATGAGAGAGAGAGAGG - Intergenic
1030341502 7:108385892-108385914 CTGTCTATGGAGAGAGAGGGAGG + Intronic
1030546976 7:110907986-110908008 ATGTCTCATGAGCAAGAGGGAGG + Intronic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031506698 7:122593771-122593793 ATGGCAAAGGAGAAAGAGAGAGG + Intronic
1031780767 7:125961017-125961039 ATGTGTGTGGAGAAAGAGAGGGG + Intergenic
1031866718 7:127044994-127045016 GTTTCTGAGGAGAAACAGAGAGG - Intronic
1032056348 7:128687691-128687713 CTGTCTCTGGAGGAGGAGACAGG + Intergenic
1032311533 7:130791726-130791748 CTCTCTTTTGAGAAAGAGAGGGG - Intergenic
1032474785 7:132204304-132204326 CTTTCTCTGGAGACTGAGAGGGG - Intronic
1032864161 7:135909332-135909354 CTGCCTCTGGAGAGAGGGAGAGG + Intergenic
1033098175 7:138448802-138448824 CTGTCTGAGGGGAAAGACTGGGG + Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033378251 7:140785809-140785831 CTGTTAGAAGAGAAAGAGAGGGG + Intronic
1034228575 7:149501494-149501516 CCATTTCAGGAGCAAGAGAGGGG - Intergenic
1036280847 8:7399893-7399915 CAGTGTCAGACGAAAGAGAGAGG - Intergenic
1036340618 8:7911678-7911700 CAGTGTCAGACGAAAGAGAGAGG + Intergenic
1037090060 8:14903038-14903060 TCGTCTCAGGAGCAAGAGAAGGG - Intronic
1037346044 8:17902306-17902328 CTGTCTCAAAAAAAAGAGTGAGG + Intronic
1038337694 8:26658844-26658866 CTGTCTCAAAAAAAAAAGAGGGG - Intergenic
1038388698 8:27174378-27174400 CTCTCTCCAGAGAGAGAGAGAGG - Intergenic
1039400778 8:37267132-37267154 CTGTCCCAGGAGAATGATGGAGG - Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042088257 8:65131855-65131877 CTGTCTGAGGGGAAAGATTGGGG + Intergenic
1042144818 8:65716751-65716773 CTGTTTCAGTACATAGAGAGTGG - Intronic
1042397624 8:68310715-68310737 CTCTCTCCTGGGAAAGAGAGGGG + Intronic
1042814507 8:72863993-72864015 CTGTCTCCAAAGAAAAAGAGGGG + Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043928310 8:86062600-86062622 CGGTGACAGGAGAAAAAGAGAGG - Intronic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1045581499 8:103485732-103485754 CTATCTCTGTAGCAAGAGAGTGG - Intergenic
1046008294 8:108513366-108513388 CTGTCTCAGGAAATAAAGAAAGG + Intergenic
1047729634 8:127716261-127716283 ATAGCTCAGGAGAAAGAGAATGG - Intergenic
1047826054 8:128576809-128576831 GTGAATCAGGAGGAAGAGAGAGG + Intergenic
1048572064 8:135664651-135664673 CTGCCTCAGGAGAGGAAGAGGGG - Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048965026 8:139609036-139609058 ATGCCTCAGGAGGAAGAGGGAGG - Intronic
1049879875 8:145054361-145054383 CTCTTTCAGAAGAGAGAGAGAGG + Exonic
1050687643 9:8190103-8190125 CTTTCTCTGGAGTGAGAGAGGGG + Intergenic
1051115320 9:13687448-13687470 CTGTCTCAGAAAAAAAAAAGAGG + Intergenic
1051344940 9:16143249-16143271 CTATCACAGGAGTCAGAGAGTGG - Intergenic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1055818003 9:80230575-80230597 CTGTCTCAAGAAAAAGAAAACGG - Intergenic
1056296053 9:85194030-85194052 CAATCTCAGCAGAAAGAGTGTGG - Intergenic
1057100662 9:92356229-92356251 CTGCCTTTGGAGAAAGAGATGGG - Intronic
1057524596 9:95787139-95787161 CAGCTTCAGGATAAAGAGAGTGG - Intergenic
1057948157 9:99347979-99348001 GTGCCTCATGAGAAAGAAAGTGG + Intergenic
1058157019 9:101527259-101527281 CTGACTCAGAAGAAAGAAAAAGG - Intronic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058938392 9:109790601-109790623 ATGTCACATGAGAAAGAGAGAGG + Intronic
1059566355 9:115386035-115386057 CTGCCAGAGGAGGAAGAGAGCGG + Intronic
1059740374 9:117144118-117144140 CTGTGTCCATAGAAAGAGAGTGG - Intronic
1059889248 9:118783042-118783064 TTGTAGCAGGAGAAAGAGATGGG + Intergenic
1059960782 9:119562538-119562560 CTGTCTAAGAAGAAAGGCAGAGG + Intergenic
1060625848 9:125110618-125110640 CTGGAGCAGGAGCAAGAGAGTGG - Intronic
1060724166 9:125996309-125996331 CTGTCTCAAAAAAAAGGGAGGGG - Intergenic
1060889528 9:127179291-127179313 CAGCCTCAGAAGACAGAGAGTGG + Intronic
1060949229 9:127590526-127590548 CTGTCTCAGGAAAAAAAAAAAGG - Intergenic
1062349911 9:136133489-136133511 CCGTCTCAGGAGGAAGGGAAGGG - Intergenic
1203569120 Un_KI270744v1:115524-115546 AGGTCTCGGGAGAAAGTGAGCGG - Intergenic
1203570069 Un_KI270744v1:121813-121835 AGGTCTCGGGAGAAAGTGAGCGG - Intergenic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186475097 X:9851011-9851033 CTGTCTCTAAAAAAAGAGAGAGG - Intronic
1186568434 X:10689316-10689338 TTGGAGCAGGAGAAAGAGAGAGG + Intronic
1186572430 X:10729264-10729286 CTTTAGCAGGACAAAGAGAGAGG - Intronic
1186590441 X:10924938-10924960 TGGTGGCAGGAGAAAGAGAGAGG + Intergenic
1188932055 X:36123794-36123816 CTGTCTAAGGTGCAAGACAGAGG + Intronic
1189834349 X:45005272-45005294 CTGTCTGAGGGGAAAGATTGGGG + Intronic
1189865370 X:45321962-45321984 CTGACTCATGAAAAAGAAAGTGG - Intergenic
1189958830 X:46305998-46306020 ATGTAGCAGGAGAGAGAGAGAGG + Intergenic
1190223942 X:48531324-48531346 CTGTCTCAGGAGAAAAAACAGGG + Intergenic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1190797125 X:53756299-53756321 CTGAGTCAGGAGAAACGGAGAGG + Intergenic
1192047948 X:67696408-67696430 CTGGCTCAGTAGTCAGAGAGAGG + Intronic
1192982140 X:76355924-76355946 GGGACTCAGGAGAAAGAGTGGGG + Intergenic
1193932894 X:87578908-87578930 CTTTCTCAGGAGGGAGAGAGAGG + Intronic
1194255173 X:91626330-91626352 CTATCACAGGAGAAAGATAAAGG + Intergenic
1196157717 X:112449275-112449297 CTGGCTTAGGGGCAAGAGAGAGG - Intergenic
1197056820 X:122131781-122131803 GTCTCCCAGGTGAAAGAGAGTGG - Intergenic
1197356329 X:125440276-125440298 CTCTCTCTGAAGAGAGAGAGGGG + Intergenic
1197415499 X:126167095-126167117 CCGTCCCAGGAGAGAGAGGGAGG - Intergenic
1198157447 X:133975430-133975452 CTGTCTCAAAAAAAAAAGAGGGG - Intronic
1199637415 X:149826664-149826686 CTGTCTGAGGGGAAAGATTGGGG - Intergenic
1199748393 X:150791258-150791280 CTGTCTAAGCAGACAGAGATAGG - Intronic
1200120714 X:153789032-153789054 CTGTCTCAGGAGGGAAGGAGGGG + Intronic
1200573900 Y:4865591-4865613 CTATCACAGGAGAAAGATAAAGG + Intergenic
1200763593 Y:7062114-7062136 CTGTCTGAGGGGAAAGACTGGGG + Intronic
1201583988 Y:15540534-15540556 GTGGATCAGGAGAGAGAGAGAGG + Intergenic