ID: 969625367

View in Genome Browser
Species Human (GRCh38)
Location 4:8302234-8302256
Sequence AGTGTGGCTCGCCCCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969625367_969625374 16 Left 969625367 4:8302234-8302256 CCACCTGTGGGGCGAGCCACACT 0: 1
1: 0
2: 2
3: 6
4: 80
Right 969625374 4:8302273-8302295 TCAGCTCCATGATGATGGTCAGG 0: 1
1: 0
2: 1
3: 17
4: 197
969625367_969625375 21 Left 969625367 4:8302234-8302256 CCACCTGTGGGGCGAGCCACACT 0: 1
1: 0
2: 2
3: 6
4: 80
Right 969625375 4:8302278-8302300 TCCATGATGATGGTCAGGAGAGG 0: 1
1: 1
2: 1
3: 12
4: 144
969625367_969625377 22 Left 969625367 4:8302234-8302256 CCACCTGTGGGGCGAGCCACACT 0: 1
1: 0
2: 2
3: 6
4: 80
Right 969625377 4:8302279-8302301 CCATGATGATGGTCAGGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 228
969625367_969625370 11 Left 969625367 4:8302234-8302256 CCACCTGTGGGGCGAGCCACACT 0: 1
1: 0
2: 2
3: 6
4: 80
Right 969625370 4:8302268-8302290 ACCCCTCAGCTCCATGATGATGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969625367 Original CRISPR AGTGTGGCTCGCCCCACAGG TGG (reversed) Intronic