ID: 969626028

View in Genome Browser
Species Human (GRCh38)
Location 4:8306247-8306269
Sequence CTCTGCCCCGGACAGCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969626028_969626041 18 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626041 4:8306288-8306310 AGGGGCCCGAATTTCCGCCTGGG 0: 1
1: 0
2: 0
3: 0
4: 39
969626028_969626045 27 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626045 4:8306297-8306319 AATTTCCGCCTGGGGAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 80
969626028_969626035 -7 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626035 4:8306263-8306285 GGCAGAGCGGAGGCTGGGCTTGG 0: 1
1: 0
2: 9
3: 104
4: 807
969626028_969626040 17 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626040 4:8306287-8306309 CAGGGGCCCGAATTTCCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 48
969626028_969626042 19 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626042 4:8306289-8306311 GGGGCCCGAATTTCCGCCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 66
969626028_969626037 -1 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626037 4:8306269-8306291 GCGGAGGCTGGGCTTGGCCAGGG 0: 1
1: 1
2: 5
3: 43
4: 411
969626028_969626036 -2 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626036 4:8306268-8306290 AGCGGAGGCTGGGCTTGGCCAGG 0: 1
1: 0
2: 0
3: 53
4: 444
969626028_969626038 0 Left 969626028 4:8306247-8306269 CCTCCTGGCTGTCCGGGGCAGAG 0: 1
1: 0
2: 0
3: 21
4: 254
Right 969626038 4:8306270-8306292 CGGAGGCTGGGCTTGGCCAGGGG 0: 1
1: 0
2: 4
3: 43
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969626028 Original CRISPR CTCTGCCCCGGACAGCCAGG AGG (reversed) Exonic
901776452 1:11563534-11563556 CTCTGTCCCCGCCAGCCAGCGGG + Intergenic
902601167 1:17540678-17540700 CTTTGGCCCTGAAAGCCAGGAGG + Intronic
903021870 1:20400470-20400492 CTGTGCCCACGGCAGCCAGGGGG - Intergenic
903326207 1:22569970-22569992 CTCTGCCCTTGACAAGCAGGTGG + Intronic
905266837 1:36760237-36760259 CTCTGCCCTGGACTGGCATGGGG + Intergenic
907038663 1:51238156-51238178 CTTCGCCCGGGTCAGCCAGGTGG + Intronic
911538873 1:99134277-99134299 CTCTCACCAGGACAGCCAGATGG - Intergenic
914824831 1:151132995-151133017 GCCTGCCCGGGACAGCCGGGCGG + Exonic
916430537 1:164723630-164723652 TTCTGCCTGGGCCAGCCAGGCGG + Intronic
918046896 1:180947099-180947121 CTCTTCCCCAGACACCCATGGGG - Exonic
919513565 1:198494732-198494754 CCCTGCCCCAGGCAGCAAGGAGG - Intergenic
920052303 1:203171518-203171540 CCATGCCCTGGACAGCCAGCGGG - Exonic
920924529 1:210329083-210329105 CGCCGCCCGGGACAGCCCGGAGG + Exonic
921583377 1:216921561-216921583 CTCTTCCCCAGACACCTAGGTGG + Intronic
922466680 1:225849361-225849383 GTCTGCCCCGGTCAGACTGGGGG - Intronic
922802073 1:228368975-228368997 CTCTGCCCCGGGGAGGCAGCAGG + Intronic
1062946692 10:1466827-1466849 CTCTGTCCCGAAGACCCAGGCGG - Intronic
1063239576 10:4153924-4153946 CTGTGCCCCTGGCTGCCAGGGGG - Intergenic
1063971579 10:11384872-11384894 CTCTGGCCCCACCAGCCAGGGGG - Intergenic
1067066064 10:43104971-43104993 CTGCGCCCCGGACAGCCTGGAGG + Exonic
1067271247 10:44793052-44793074 CTTCTCCCTGGACAGCCAGGAGG + Intergenic
1067537421 10:47124060-47124082 CTGTGCCCCGTGGAGCCAGGGGG + Intergenic
1070827561 10:79399976-79399998 CTTTGCCCTGGTCAGGCAGGTGG + Intronic
1071288770 10:84173082-84173104 CTCTGCCCAGGGCAGGCATGGGG - Intergenic
1071305563 10:84296097-84296119 CTCTGTCCCAGAGAGCCTGGGGG + Intergenic
1072736970 10:97885716-97885738 CTGTGCCCAGCACAGACAGGGGG + Intronic
1072805842 10:98423715-98423737 CCCTGCCCTGGCCACCCAGGGGG + Intronic
1074665382 10:115716790-115716812 CTATGTCTCGGACATCCAGGAGG - Intronic
1074962464 10:118459740-118459762 CTCTGCCCAGGAAAGCCAGTGGG + Intergenic
1075476530 10:122739917-122739939 CACTGCCCAGGACAGGCAGGTGG + Intergenic
1075686203 10:124366971-124366993 CTCTTCACGTGACAGCCAGGTGG + Intergenic
1075732531 10:124644958-124644980 CTCTCCCCCTGAATGCCAGGGGG + Intronic
1075782676 10:125027078-125027100 CCCTGCCCCTGCCAGACAGGTGG - Exonic
1076021394 10:127076763-127076785 CTCTGCCCAGGGCTGACAGGGGG + Intronic
1076342898 10:129761779-129761801 CTGTGCCGAGGGCAGCCAGGCGG + Intronic
1076594957 10:131619631-131619653 CCCTGCCCCGCAAACCCAGGTGG + Intergenic
1076595224 10:131620837-131620859 CCCTGCCCCGCAAACCCAGGTGG - Intergenic
1076669796 10:132113475-132113497 CTCAGGCTGGGACAGCCAGGTGG - Intronic
1077551185 11:3200994-3201016 CCCAGCCCCGCACAGCCAGAGGG - Intergenic
1081834575 11:46143312-46143334 CTTTGCCCCGGGCAGCCAGAAGG + Intergenic
1083664578 11:64267517-64267539 CGCTGACTCGGAGAGCCAGGAGG + Exonic
1083756862 11:64796604-64796626 CTCTGCCCCCCACAGCCAGCCGG + Intronic
1084182827 11:67455229-67455251 CTCTGCCCTGGCCAGCCCTGGGG + Intronic
1084744266 11:71157979-71158001 CCCAGCCACGGACAGCCTGGGGG + Intronic
1084904410 11:72334782-72334804 CCCAGCCCCAGACAGCCAGTGGG - Intronic
1085218504 11:74852646-74852668 CTGTGTCCCAGACAGCCATGAGG - Intronic
1085739918 11:79069851-79069873 CTCGTCCGCGGACAGCGAGGAGG - Exonic
1089351402 11:117823624-117823646 ACTTGCCCCGGACAGCCAGACGG + Intronic
1089495630 11:118907510-118907532 CTCTGGACCGGACAGTGAGGAGG - Exonic
1091791325 12:3273778-3273800 GCCTGCCCCGCACAGGCAGGAGG - Intronic
1092089587 12:5793597-5793619 CTCTGCCCTGGAATTCCAGGTGG + Intronic
1092117480 12:6019542-6019564 CTCAGCCTCGGACAGCCTGGAGG + Exonic
1092776142 12:11946593-11946615 ATCTGCCCCTGGCAGCAAGGGGG + Intergenic
1095049513 12:37543762-37543784 CTCTGCTCCTGGCAGTCAGGCGG - Intergenic
1101617616 12:106353549-106353571 ACCTGCCCAGGACAGCCATGTGG - Intergenic
1101777275 12:107806289-107806311 CTCTGCCCAGGGCAGCCCTGAGG + Intergenic
1102465820 12:113130397-113130419 CTGTGCCCTGCACAGCCACGAGG + Intronic
1103412296 12:120721033-120721055 CTCTGCACTGCACAGCCTGGAGG + Exonic
1104162210 12:126191554-126191576 CTGAGCCCCGCACAGCCCGGGGG - Intergenic
1104389387 12:128378717-128378739 CTCTGCTCGGGACAGCAAGAAGG + Intronic
1104690432 12:130821621-130821643 CTGTGCCGCAGACAGCCAGAGGG + Intronic
1105293828 13:19071559-19071581 CTCTGGCCCAGGCACCCAGGTGG - Intergenic
1107426847 13:40302529-40302551 CTTTTCCCAGCACAGCCAGGGGG + Intergenic
1111919665 13:94396818-94396840 CACTGCCCCAGACTGCCTGGAGG - Intronic
1112402409 13:99087451-99087473 CTCCGCGCCGGACCGCCAGGCGG + Intergenic
1112656111 13:101453900-101453922 CTCGGCCCGGGACAGCCTGCAGG - Exonic
1113906292 13:113820811-113820833 CTCTGTCCGAGACAGCCGGGAGG - Exonic
1115664536 14:35533721-35533743 CTCTGCGCCGGACGGCCGAGCGG - Intergenic
1116633072 14:47358066-47358088 CTCTGCCCCAGAAAACCAGTTGG + Intronic
1117875999 14:60249938-60249960 CTCGGCCGCGGACGGCCAGAGGG - Intronic
1118752378 14:68816547-68816569 CTCTGCCCCGGCCGGCCTGCCGG + Intergenic
1118791156 14:69094291-69094313 GTCTGCCCAGGACAGGCATGTGG + Intronic
1120259498 14:82163758-82163780 CTCTTCTCAGCACAGCCAGGGGG - Intergenic
1121744533 14:96277982-96278004 CTCTGCACAGGAGAGACAGGAGG - Intergenic
1122546315 14:102524635-102524657 CTCCGCCCCGGACCACCAGGGGG + Intergenic
1122938705 14:104971724-104971746 CTTTGCTCTGGGCAGCCAGGAGG + Intronic
1128513321 15:68326874-68326896 CTCTCCCCTGGCCAGCCTGGGGG - Intronic
1128864004 15:71099168-71099190 CTCTTCCCCAGACCACCAGGAGG - Intronic
1128943924 15:71809041-71809063 CTCTGTCCCGGGCAGGGAGGGGG + Intronic
1130269805 15:82440284-82440306 CTCTGGCCCTGACAGCCAACTGG + Intergenic
1130462144 15:84167585-84167607 CTCTGGCCCTGACAGCCAACTGG + Intergenic
1130490533 15:84427188-84427210 CTCTGGCCCTGACAGCCAACTGG - Intergenic
1130502121 15:84505958-84505980 CTCTGGCCCTGACAGCCAACTGG - Intergenic
1131451378 15:92543114-92543136 CTCTGCCCAGGACACCAATGTGG - Intergenic
1132038532 15:98505724-98505746 CCCGGCCCAGGACAGCCATGCGG + Intronic
1132372634 15:101308984-101309006 CGCTGCGGTGGACAGCCAGGAGG + Intronic
1136066466 16:27762164-27762186 CCCTGCCCTGCACAGCCAGAGGG + Intronic
1136100062 16:27987483-27987505 CCCTTCCCAGCACAGCCAGGGGG - Intronic
1136688302 16:32009090-32009112 CTGTGTCCAGGACACCCAGGCGG + Intergenic
1136788903 16:32952645-32952667 CTGTGTCCAGGACACCCAGGCGG + Intergenic
1136880909 16:33901289-33901311 CTGTGTCCAGGACACCCAGGCGG - Intergenic
1138076742 16:54050087-54050109 CTGTTCCCCAGGCAGCCAGGAGG - Intronic
1139215232 16:65120979-65121001 CTCTGCCCCGGAACGCGAGCCGG - Intronic
1139440652 16:66964991-66965013 CTCTGCCCCAGGCAGCATGGTGG + Intronic
1141459561 16:84169993-84170015 CTCTGCCCGGAAAAGCCAAGTGG + Exonic
1141804490 16:86333895-86333917 CTCTCCCCAGGACAGCCACAAGG - Intergenic
1142066429 16:88065557-88065579 CTCTGCCCAGCACAGCGAGCTGG + Intronic
1142155234 16:88529978-88530000 CACTGCCCCAGGGAGCCAGGAGG + Intronic
1142211538 16:88810947-88810969 CCCTGCCCCGGCCTGGCAGGAGG + Intronic
1142239132 16:88937174-88937196 CTCTGCCCAGGAAAGTCAGGAGG + Intronic
1203091100 16_KI270728v1_random:1214134-1214156 CTGTGTCCAGGACACCCAGGCGG + Intergenic
1142559293 17:800554-800576 CACGGCCCCGGACGGCCAGAGGG - Exonic
1142806715 17:2375314-2375336 TTCTGACCCAGCCAGCCAGGCGG - Intronic
1143094035 17:4467241-4467263 CTCTGCGCTGGACAGTCTGGTGG - Intronic
1143104135 17:4519965-4519987 CTCTGCTCAGGACAGACAGGAGG - Intronic
1143518003 17:7429662-7429684 CTCTGGCCTGGAGAGCAAGGAGG - Intergenic
1143670543 17:8393067-8393089 CTCTGGCCCGGGCTGCCTGGCGG + Exonic
1146819282 17:35971600-35971622 CTTTGCCCCTGAGAGCCAGAGGG - Intergenic
1147149290 17:38504796-38504818 CTGTGTCCAGGACACCCAGGCGG + Intronic
1148554695 17:48571386-48571408 CTCTGCCCAGGACAGGCGGGTGG + Intronic
1149658616 17:58323238-58323260 CTTCACCCCGGCCAGCCAGGTGG - Intronic
1150313029 17:64145181-64145203 CTGTTCCCCGGACATACAGGTGG - Intergenic
1150690995 17:67366669-67366691 CACTGCCGCGGACAGCCTGGGGG + Intergenic
1151745593 17:76010108-76010130 CCCCGGCCTGGACAGCCAGGCGG - Exonic
1152123915 17:78435085-78435107 CTCTGTCCCAGGCAGCCAGGAGG - Intronic
1152242687 17:79168527-79168549 CCCTGACCCTGCCAGCCAGGAGG + Intronic
1152366988 17:79862124-79862146 CAGTGGCCTGGACAGCCAGGAGG + Intergenic
1153103742 18:1504032-1504054 CTCTGCTCTAGACAGCCCGGTGG - Intergenic
1153126405 18:1797186-1797208 CCCTGCTCCTGACAGACAGGTGG - Intergenic
1156458340 18:37307170-37307192 CACTGACCCTCACAGCCAGGTGG - Intronic
1158437210 18:57441978-57442000 CTCGGCCCAGGACGTCCAGGGGG - Intronic
1159025707 18:63180635-63180657 CTCTGCCTCGGAGAAGCAGGGGG + Intronic
1159523112 18:69551584-69551606 CTCTGCTCAGGAAATCCAGGAGG + Intronic
1160425151 18:78774080-78774102 CTGTGTCCCCCACAGCCAGGCGG - Intergenic
1160663852 19:313723-313745 CTCAGCCCCTGACAGGGAGGAGG + Intronic
1160728275 19:628289-628311 CTCTGCCCAGGGAATCCAGGGGG + Intronic
1160793779 19:934595-934617 CACTGCCCGGTACACCCAGGGGG - Intronic
1160806957 19:996153-996175 CTCAGCCCCGGACGGCCGCGTGG - Intronic
1161769453 19:6223383-6223405 CTCTGCCTCGGAAACCCCGGGGG + Intronic
1161911594 19:7198318-7198340 CTCTGGCCGGGACCGCCCGGCGG - Intronic
1162060875 19:8094460-8094482 CTCTGCACCTGGAAGCCAGGGGG + Exonic
1162939158 19:13997688-13997710 CTCTGTTCCTGCCAGCCAGGAGG - Intronic
1164565810 19:29324975-29324997 CCCTCACCCGGACTGCCAGGCGG + Intergenic
1165052543 19:33151212-33151234 CTTTGACCCCGACAGCCAGAGGG + Exonic
1166014614 19:39970843-39970865 CTCTGGCACGGACAGTCTGGCGG - Intergenic
1167292022 19:48629744-48629766 TCCCGCCCCGGGCAGCCAGGAGG - Exonic
1167648834 19:50719118-50719140 CTTGGCCCCGGAGAGCCGGGAGG + Intronic
1168266774 19:55227722-55227744 CTCTGCTCAGAACTGCCAGGAGG + Intronic
927565088 2:24104810-24104832 CCTTGCCACTGACAGCCAGGTGG + Intronic
927931845 2:27050467-27050489 CGCTGCCCCGGAGCTCCAGGAGG + Intronic
927948917 2:27154463-27154485 CTCTGCCCTGGCCAGCCCTGTGG - Exonic
927954453 2:27198925-27198947 CTCTGCCCTGGCCAGCCCTGTGG - Intergenic
928427890 2:31193539-31193561 ATCTCCCCCGGTCAGCCATGTGG - Intronic
929000706 2:37344793-37344815 CCCTGCCCTGGGCATCCAGGGGG + Exonic
929411855 2:41705883-41705905 CTCTGCCCCTCATAGTCAGGAGG + Intergenic
932340683 2:70961120-70961142 CAGTGTCCCGGCCAGCCAGGAGG + Intronic
932419420 2:71592672-71592694 CTCTGCCCCAGACACCCGGCAGG - Intronic
934555890 2:95286839-95286861 CTCTGCCCCGAATCTCCAGGTGG + Exonic
935673046 2:105571872-105571894 ACCTGCCAAGGACAGCCAGGAGG - Intergenic
937916003 2:127099017-127099039 CCCTGCCCCGGCCACCCTGGAGG - Intronic
938455651 2:131460918-131460940 CTCAGCCCCGGCCCGCCTGGGGG - Intergenic
940019424 2:149141228-149141250 CTCTGCCCCAGACAGTCACATGG - Intronic
941848772 2:170158507-170158529 CTGTGCCCCAGACAGCCACCTGG - Intergenic
942142787 2:172994556-172994578 CTATGCCCTAGACAGCTAGGTGG - Intronic
942152549 2:173091504-173091526 CTCTTCCCTGGGCAGCCAAGAGG + Intronic
945381323 2:209145224-209145246 CTCAGCCCCAGCCAGCCATGGGG + Intergenic
945761857 2:213923869-213923891 TTTTGCCATGGACAGCCAGGTGG - Intronic
946113096 2:217437436-217437458 CGCTGCCCAGGTCAGCAAGGGGG - Intronic
948483385 2:238264339-238264361 CTCTGCCCCAGGCAGCCCCGCGG + Intronic
948788166 2:240363832-240363854 CTTTGCCGGGGACAGGCAGGCGG - Intergenic
948865054 2:240770988-240771010 GTTTGCCCCGGGCAGCGAGGAGG - Exonic
948903611 2:240967806-240967828 CTCTCCCCCAGACAGCCACACGG + Intronic
949036301 2:241817072-241817094 CTCTGCCCCAGGCACCCAAGGGG - Exonic
1174146606 20:48456515-48456537 CTGAGCCCCTGAGAGCCAGGAGG - Intergenic
1175246106 20:57583037-57583059 CCCTGCCCTCCACAGCCAGGAGG - Intergenic
1175829584 20:61954810-61954832 CTCTGCCCCGCGCCACCAGGAGG - Intronic
1175913008 20:62413602-62413624 CTCAGCCCTGGACAGCCGGTGGG + Intronic
1176239093 20:64067724-64067746 CTCTGGCCAGGACAGGCAGGAGG + Intronic
1176310554 21:5146742-5146764 CTCGGCTCCGAACACCCAGGTGG + Exonic
1176388627 21:6152071-6152093 CTGTGCCCCTGGCAGGCAGGCGG + Intergenic
1177320474 21:19513578-19513600 CCCTGCCTCTGATAGCCAGGTGG + Intergenic
1179734845 21:43386177-43386199 CTGTGCCCCTGGCAGGCAGGCGG - Intergenic
1179846501 21:44115293-44115315 CTCGGCTCCGAACACCCAGGTGG - Exonic
1179922391 21:44514145-44514167 CACTGCCCAGGACAGCCTGAAGG - Intronic
1179972904 21:44846076-44846098 CTCTGGCCCTGGCAGCCTGGAGG + Intergenic
1179979717 21:44889648-44889670 TTCTGCCCCCGCCAGCCACGTGG + Intronic
1180223848 21:46377234-46377256 CCCTGCCCAGCACGGCCAGGAGG - Intronic
1180568917 22:16697955-16697977 CTCAGCCTCGGACAGCCTGGAGG + Intergenic
1182234398 22:28864183-28864205 CTCTACCCAGGTCATCCAGGAGG - Intergenic
1182280509 22:29215451-29215473 CACTGCCCTGGACACCCATGGGG - Intronic
1184815305 22:46864430-46864452 CACTTCCACAGACAGCCAGGAGG - Intronic
1184853685 22:47135201-47135223 CCCTGCGCCGGCCTGCCAGGGGG - Intronic
1185102548 22:48849389-48849411 CCCAGCCCCGGACAGCCTGGAGG - Intronic
1185205207 22:49533976-49533998 CTCTGCCCCGGCCAGCAGAGCGG + Intronic
1185320778 22:50199415-50199437 CTGTGTCCTGGACAGCCAGGAGG - Exonic
1185334663 22:50266159-50266181 CTCTCCCCCAGAGAGCCTGGGGG + Intronic
1185402668 22:50626918-50626940 CTCTAGTCCGGGCAGCCAGGGGG + Exonic
949982498 3:9510558-9510580 CTCTGCTCCAAGCAGCCAGGAGG + Intronic
950128492 3:10526217-10526239 CTCTGCCTGGGAGGGCCAGGAGG + Intronic
950863934 3:16174235-16174257 CTCTGCCCTGGCCACCAAGGGGG - Intergenic
953518757 3:43621862-43621884 CTCTGCTGCGGACAGCTGGGGGG + Intronic
953618116 3:44510385-44510407 CTCTGCCCCAGACGCCCGGGGGG + Intronic
953891746 3:46756256-46756278 CTCCGCCCTGGGCAGCCTGGTGG - Exonic
953947880 3:47164392-47164414 CGCTGCCCCCGGCCGCCAGGCGG - Intergenic
955161430 3:56468304-56468326 CTTGGCCCCGGGCGGCCAGGAGG + Exonic
961451525 3:127004409-127004431 CTCTGCCCTGGAAACCCAGGGGG - Intronic
961822297 3:129581256-129581278 CTCTGCCCCGGGCGTGCAGGAGG - Intronic
962168713 3:133077915-133077937 GTCTTCCCAGGACAGCCCGGGGG + Intronic
965519997 3:169662224-169662246 CTCCGCGCCGGGCAGGCAGGGGG + Intronic
968737264 4:2303925-2303947 CACTGCCCCGCACAGGCACGCGG + Intronic
968977544 4:3829892-3829914 CCCTGCCCCTCCCAGCCAGGTGG - Intergenic
969626028 4:8306247-8306269 CTCTGCCCCGGACAGCCAGGAGG - Exonic
973844592 4:54898420-54898442 CTCTGCCTAGGACAGCTGGGAGG - Intergenic
978846099 4:113274574-113274596 CTCTGCCCGGGAGGGCCAGGTGG + Exonic
986269967 5:6221429-6221451 CGCTGGCCCGGCCAGTCAGGTGG - Intergenic
988910532 5:35836633-35836655 CTCTTCCCCGGTCAGCCACCCGG - Intergenic
991636699 5:68713143-68713165 CTTTGACCCTGACAACCAGGAGG + Intergenic
995644873 5:114299987-114300009 CTATGCCCCAGAAAGCCTGGTGG + Intergenic
997820205 5:137058765-137058787 CTCTTCCCCAGACATCCATGGGG - Intronic
999318324 5:150598430-150598452 CACTGCCACGGACAGGCTGGGGG + Intergenic
999755808 5:154663612-154663634 CTATGCCCAGGAAAGCCACGGGG - Intergenic
1001057977 5:168464997-168465019 CTCTGCCCCAGAGAGTCGGGGGG + Intronic
1002344983 5:178542512-178542534 CTTTCCCCCGGTCAGCCAGAGGG - Intronic
1004348013 6:14866275-14866297 CAATGCCCCGAACAGGCAGGAGG - Intergenic
1005178738 6:23078871-23078893 CTCTTCCCTTGACAGCCGGGAGG - Intergenic
1005582708 6:27249550-27249572 CTCTGCCCTTGACTTCCAGGTGG + Intronic
1005900725 6:30214324-30214346 GTCTTTCCCGGCCAGCCAGGCGG + Intergenic
1006845232 6:37056862-37056884 CTCTGCCCTGGACACCATGGAGG - Intergenic
1007825935 6:44600555-44600577 CTCTGCCACGGGCAGCATGGAGG + Intergenic
1013418414 6:109945129-109945151 CTCTCCCAAGGACATCCAGGGGG + Intergenic
1013480681 6:110550394-110550416 CCCTTCCCGGGAGAGCCAGGTGG + Intergenic
1014861286 6:126470684-126470706 CTGTGCCCTGTACAGCCAGAGGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018897163 6:168027668-168027690 CTCCTCCCCGGACAGCCGCGTGG + Intronic
1019477714 7:1251984-1252006 CTTTGCCCCTGCCTGCCAGGGGG - Intergenic
1019488533 7:1300512-1300534 CTGTGCGCAGGGCAGCCAGGAGG - Intergenic
1019501866 7:1368805-1368827 CTCTCCCCAGGACACCCAGCCGG + Intergenic
1021227323 7:18043379-18043401 CTGTGCCCAGGACAACCAAGAGG + Intergenic
1024216520 7:47253726-47253748 CACTGCCCCGGAGACACAGGAGG - Intergenic
1024669821 7:51584393-51584415 CTCTGCACCACACAGCCAGAAGG - Intergenic
1024978699 7:55137648-55137670 ACCTGCCCCTGACAGCCAAGTGG + Intronic
1025107012 7:56179758-56179780 CTCTGACCAGGTCAGCCAGTGGG + Intergenic
1026255482 7:68707603-68707625 TTCTGGCCTGGACAGGCAGGTGG - Intergenic
1029622501 7:101698874-101698896 CTAGGCCCAGGGCAGCCAGGGGG - Intergenic
1031935022 7:127727233-127727255 GCCTGCCCTGGAGAGCCAGGCGG - Intronic
1032001360 7:128267566-128267588 CTCTTCCCCGGACCCCCTGGCGG - Intergenic
1035127530 7:156619212-156619234 CTCACCCCCGCTCAGCCAGGGGG - Intergenic
1037605788 8:20436002-20436024 CTCTGCCCAGAATAGCCTGGAGG + Intergenic
1037969701 8:23163551-23163573 CGCCGCACGGGACAGCCAGGGGG + Intronic
1040302566 8:46195578-46195600 GTCTGCCCAGGACAGCCTTGGGG - Intergenic
1040307829 8:46221357-46221379 GTCTGCCCAGGACAGCCCCGGGG - Intergenic
1040310260 8:46233205-46233227 ACCCGCCCCGGACAGCCATGGGG - Intergenic
1040324530 8:46335023-46335045 GTCTGCCCGGGACAGCCTTGTGG - Intergenic
1040338818 8:46429676-46429698 GCCTGCCCGGGACAGCCTGGGGG - Intergenic
1041225023 8:55689519-55689541 CTCTGCCCCGCGCAGCCGGATGG - Intergenic
1047788613 8:128178812-128178834 CTCTGCCCCGAACAGTTACGTGG + Intergenic
1047789805 8:128191387-128191409 GTTTGCCCTGGGCAGCCAGGTGG + Intergenic
1048844577 8:138594514-138594536 GACAGCCACGGACAGCCAGGTGG + Intronic
1049205479 8:141361632-141361654 CACTGCCCCCGCCAGCCTGGAGG + Intronic
1049212497 8:141393113-141393135 CTCTGCACAGGGCTGCCAGGCGG - Intronic
1049249847 8:141582440-141582462 CTCAGCCCCCGACTGCCAGCAGG + Intergenic
1049469154 8:142767660-142767682 CTCTGCCCTGGAAACCAAGGAGG - Intronic
1057182039 9:93035526-93035548 CACGGCCCAGGACAGCCCGGGGG + Exonic
1057878238 9:98773910-98773932 CGCTGCCCCAGAGAGCCAGCAGG - Exonic
1059231559 9:112725795-112725817 CTGTGCCCAGGAAAGCCATGGGG - Intergenic
1060519636 9:124287041-124287063 CTCTGTCCCCCGCAGCCAGGGGG - Intronic
1060537115 9:124399403-124399425 CTCCGCCAGGGGCAGCCAGGAGG + Intronic
1061766301 9:132883713-132883735 CTCTGTCATGGACAGCCTGGGGG + Intronic
1062103327 9:134739498-134739520 CTCTGCCCCGGACAGCAGGCAGG - Intronic
1062424652 9:136500487-136500509 CACTGCCCCAGACCACCAGGCGG + Intronic
1062479734 9:136745737-136745759 CTCCGCTCCCGAGAGCCAGGAGG - Intronic
1062536603 9:137023797-137023819 TGCTGCCCAGGCCAGCCAGGAGG + Intronic
1185463160 X:341531-341553 CTCCTCCCCGGAGAGGCAGGAGG - Intronic
1185541927 X:909029-909051 CTCTGCCCAGGCCACCAAGGAGG + Intergenic
1187104160 X:16223064-16223086 CTGTGCCCAGGAAAGCCATGGGG - Intergenic
1187272683 X:17793016-17793038 CCCTTCCCTGGACAGCCTGGAGG + Intergenic
1187424042 X:19161152-19161174 CCCAGCCCAGCACAGCCAGGTGG + Intergenic
1189873082 X:45404699-45404721 CCCTGCCACTGATAGCCAGGTGG + Intergenic
1190635373 X:52427476-52427498 CTCTTCCCAGGACAGACATGAGG - Intergenic
1190999513 X:55645681-55645703 CTCTTCCCAGGGCAGACAGGAGG + Intergenic
1192218561 X:69180955-69180977 CTCAGCCCAGTATAGCCAGGAGG - Intergenic
1192437748 X:71153346-71153368 CTGGGCCCAGGACAGGCAGGAGG - Intronic
1193089793 X:77482011-77482033 CCCTGCCACTGACAGCCAGGTGG + Intergenic
1200075019 X:153546582-153546604 CTCAGCCCCGGACAGCTGGCAGG + Intronic
1200135762 X:153873847-153873869 CTCTGCCCCAGAGAGCTTGGTGG - Intronic
1201147928 Y:11075652-11075674 CCCAGCCACGGACAGCCTGGGGG + Intergenic