ID: 969627943

View in Genome Browser
Species Human (GRCh38)
Location 4:8317183-8317205
Sequence ACTCCTGTCGTCCCTGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969627938_969627943 10 Left 969627938 4:8317150-8317172 CCAAGGGGAGAGGGAGCTGGGTG No data
Right 969627943 4:8317183-8317205 ACTCCTGTCGTCCCTGGCCGAGG No data
969627935_969627943 13 Left 969627935 4:8317147-8317169 CCACCAAGGGGAGAGGGAGCTGG No data
Right 969627943 4:8317183-8317205 ACTCCTGTCGTCCCTGGCCGAGG No data
969627934_969627943 14 Left 969627934 4:8317146-8317168 CCCACCAAGGGGAGAGGGAGCTG No data
Right 969627943 4:8317183-8317205 ACTCCTGTCGTCCCTGGCCGAGG No data
969627932_969627943 19 Left 969627932 4:8317141-8317163 CCTCGCCCACCAAGGGGAGAGGG No data
Right 969627943 4:8317183-8317205 ACTCCTGTCGTCCCTGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969627943 Original CRISPR ACTCCTGTCGTCCCTGGCCG AGG Intergenic