ID: 969628410

View in Genome Browser
Species Human (GRCh38)
Location 4:8320576-8320598
Sequence GCCGTCCCTCCTCATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969628402_969628410 18 Left 969628402 4:8320535-8320557 CCCTCTCTGGGCCTCAGCTTCTA No data
Right 969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG No data
969628403_969628410 17 Left 969628403 4:8320536-8320558 CCTCTCTGGGCCTCAGCTTCTAT No data
Right 969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG No data
969628405_969628410 7 Left 969628405 4:8320546-8320568 CCTCAGCTTCTATGCACAGGAAG No data
Right 969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969628410 Original CRISPR GCCGTCCCTCCTCATGGGGG TGG Intergenic
No off target data available for this crispr