ID: 969629180

View in Genome Browser
Species Human (GRCh38)
Location 4:8325579-8325601
Sequence GGCCTGCAGTGCGGACAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969629180_969629186 -7 Left 969629180 4:8325579-8325601 CCAACCTGTCCGCACTGCAGGCC No data
Right 969629186 4:8325595-8325617 GCAGGCCAGACATGCTGGGGAGG No data
969629180_969629185 -10 Left 969629180 4:8325579-8325601 CCAACCTGTCCGCACTGCAGGCC No data
Right 969629185 4:8325592-8325614 ACTGCAGGCCAGACATGCTGGGG No data
969629180_969629190 24 Left 969629180 4:8325579-8325601 CCAACCTGTCCGCACTGCAGGCC No data
Right 969629190 4:8325626-8325648 ACAGTTGCCCTCTACCAGGAGGG No data
969629180_969629189 23 Left 969629180 4:8325579-8325601 CCAACCTGTCCGCACTGCAGGCC No data
Right 969629189 4:8325625-8325647 TACAGTTGCCCTCTACCAGGAGG No data
969629180_969629188 20 Left 969629180 4:8325579-8325601 CCAACCTGTCCGCACTGCAGGCC No data
Right 969629188 4:8325622-8325644 GTCTACAGTTGCCCTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969629180 Original CRISPR GGCCTGCAGTGCGGACAGGT TGG (reversed) Intergenic
No off target data available for this crispr