ID: 969630699

View in Genome Browser
Species Human (GRCh38)
Location 4:8334246-8334268
Sequence TTGGGCAGTGACTGGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630693_969630699 19 Left 969630693 4:8334204-8334226 CCATGGATTTAAGGGAGAGATTC No data
Right 969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG No data
969630692_969630699 22 Left 969630692 4:8334201-8334223 CCACCATGGATTTAAGGGAGAGA No data
Right 969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG No data
969630690_969630699 27 Left 969630690 4:8334196-8334218 CCTTGCCACCATGGATTTAAGGG No data
Right 969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630699 Original CRISPR TTGGGCAGTGACTGGCTAGA AGG Intergenic
No off target data available for this crispr