ID: 969630739

View in Genome Browser
Species Human (GRCh38)
Location 4:8334515-8334537
Sequence CTGCTCTTGCAGGACAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630739_969630746 27 Left 969630739 4:8334515-8334537 CCCTTGCTGTCCTGCAAGAGCAG No data
Right 969630746 4:8334565-8334587 TCTCTTAACCCTTTGGGGCCGGG No data
969630739_969630743 21 Left 969630739 4:8334515-8334537 CCCTTGCTGTCCTGCAAGAGCAG No data
Right 969630743 4:8334559-8334581 GCAAATTCTCTTAACCCTTTGGG No data
969630739_969630742 20 Left 969630739 4:8334515-8334537 CCCTTGCTGTCCTGCAAGAGCAG No data
Right 969630742 4:8334558-8334580 AGCAAATTCTCTTAACCCTTTGG No data
969630739_969630745 26 Left 969630739 4:8334515-8334537 CCCTTGCTGTCCTGCAAGAGCAG No data
Right 969630745 4:8334564-8334586 TTCTCTTAACCCTTTGGGGCCGG No data
969630739_969630744 22 Left 969630739 4:8334515-8334537 CCCTTGCTGTCCTGCAAGAGCAG No data
Right 969630744 4:8334560-8334582 CAAATTCTCTTAACCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630739 Original CRISPR CTGCTCTTGCAGGACAGCAA GGG (reversed) Intergenic
No off target data available for this crispr