ID: 969630803

View in Genome Browser
Species Human (GRCh38)
Location 4:8334897-8334919
Sequence AAGCCAGGAGGGTCCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630803_969630814 20 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630814 4:8334940-8334962 GGTCAGTGCTCACCTGCCCCTGG No data
969630803_969630811 -8 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630811 4:8334912-8334934 CCTGGCTTCTCTGGAGCCTTGGG No data
969630803_969630809 -9 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630809 4:8334911-8334933 TCCTGGCTTCTCTGGAGCCTTGG No data
969630803_969630812 -1 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630812 4:8334919-8334941 TCTCTGGAGCCTTGGGTGAGTGG No data
969630803_969630816 22 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630816 4:8334942-8334964 TCAGTGCTCACCTGCCCCTGGGG No data
969630803_969630817 28 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630803_969630815 21 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630815 4:8334941-8334963 GTCAGTGCTCACCTGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630803 Original CRISPR AAGCCAGGAGGGTCCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr