ID: 969630804

View in Genome Browser
Species Human (GRCh38)
Location 4:8334900-8334922
Sequence GAGAAGCCAGGAGGGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630804_969630814 17 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630814 4:8334940-8334962 GGTCAGTGCTCACCTGCCCCTGG No data
969630804_969630816 19 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630816 4:8334942-8334964 TCAGTGCTCACCTGCCCCTGGGG No data
969630804_969630812 -4 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630812 4:8334919-8334941 TCTCTGGAGCCTTGGGTGAGTGG No data
969630804_969630815 18 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630815 4:8334941-8334963 GTCAGTGCTCACCTGCCCCTGGG No data
969630804_969630817 25 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630804 Original CRISPR GAGAAGCCAGGAGGGTCCCT GGG (reversed) Intergenic
No off target data available for this crispr