ID: 969630807

View in Genome Browser
Species Human (GRCh38)
Location 4:8334908-8334930
Sequence AGGCTCCAGAGAAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630807_969630816 11 Left 969630807 4:8334908-8334930 CCCTCCTGGCTTCTCTGGAGCCT No data
Right 969630816 4:8334942-8334964 TCAGTGCTCACCTGCCCCTGGGG No data
969630807_969630817 17 Left 969630807 4:8334908-8334930 CCCTCCTGGCTTCTCTGGAGCCT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630807_969630815 10 Left 969630807 4:8334908-8334930 CCCTCCTGGCTTCTCTGGAGCCT No data
Right 969630815 4:8334941-8334963 GTCAGTGCTCACCTGCCCCTGGG No data
969630807_969630814 9 Left 969630807 4:8334908-8334930 CCCTCCTGGCTTCTCTGGAGCCT No data
Right 969630814 4:8334940-8334962 GGTCAGTGCTCACCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630807 Original CRISPR AGGCTCCAGAGAAGCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr