ID: 969630808

View in Genome Browser
Species Human (GRCh38)
Location 4:8334909-8334931
Sequence AAGGCTCCAGAGAAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630808_969630817 16 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630808_969630814 8 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630814 4:8334940-8334962 GGTCAGTGCTCACCTGCCCCTGG No data
969630808_969630822 30 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630822 4:8334962-8334984 GGGTTGTGGCACTATACGATTGG No data
969630808_969630815 9 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630815 4:8334941-8334963 GTCAGTGCTCACCTGCCCCTGGG No data
969630808_969630816 10 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630816 4:8334942-8334964 TCAGTGCTCACCTGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630808 Original CRISPR AAGGCTCCAGAGAAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr