ID: 969630813

View in Genome Browser
Species Human (GRCh38)
Location 4:8334928-8334950
Sequence GAGCACTGACCACTCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630813_969630815 -10 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630815 4:8334941-8334963 GTCAGTGCTCACCTGCCCCTGGG No data
969630813_969630816 -9 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630816 4:8334942-8334964 TCAGTGCTCACCTGCCCCTGGGG No data
969630813_969630817 -3 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630813_969630822 11 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630822 4:8334962-8334984 GGGTTGTGGCACTATACGATTGG No data
969630813_969630823 12 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630823 4:8334963-8334985 GGTTGTGGCACTATACGATTGGG No data
969630813_969630825 28 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630813_969630824 27 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630813 Original CRISPR GAGCACTGACCACTCACCCA AGG (reversed) Intergenic