ID: 969630817

View in Genome Browser
Species Human (GRCh38)
Location 4:8334948-8334970
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630808_969630817 16 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630807_969630817 17 Left 969630807 4:8334908-8334930 CCCTCCTGGCTTCTCTGGAGCCT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630804_969630817 25 Left 969630804 4:8334900-8334922 CCCAGGGACCCTCCTGGCTTCTC No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630805_969630817 24 Left 969630805 4:8334901-8334923 CCAGGGACCCTCCTGGCTTCTCT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630810_969630817 13 Left 969630810 4:8334912-8334934 CCTGGCTTCTCTGGAGCCTTGGG No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630803_969630817 28 Left 969630803 4:8334897-8334919 CCTCCCAGGGACCCTCCTGGCTT No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data
969630813_969630817 -3 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630817 4:8334948-8334970 CTCACCTGCCCCTGGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr