ID: 969630819

View in Genome Browser
Species Human (GRCh38)
Location 4:8334956-8334978
Sequence GTATAGTGCCACAACCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630819_969630826 10 Left 969630819 4:8334956-8334978 CCCCTGGGGTTGTGGCACTATAC No data
Right 969630826 4:8334989-8335011 TTCCCAGTCAGGGTTCCTTCTGG No data
969630819_969630825 0 Left 969630819 4:8334956-8334978 CCCCTGGGGTTGTGGCACTATAC No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630819_969630824 -1 Left 969630819 4:8334956-8334978 CCCCTGGGGTTGTGGCACTATAC No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630819 Original CRISPR GTATAGTGCCACAACCCCAG GGG (reversed) Intergenic