ID: 969630822

View in Genome Browser
Species Human (GRCh38)
Location 4:8334962-8334984
Sequence GGGTTGTGGCACTATACGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630813_969630822 11 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630822 4:8334962-8334984 GGGTTGTGGCACTATACGATTGG No data
969630808_969630822 30 Left 969630808 4:8334909-8334931 CCTCCTGGCTTCTCTGGAGCCTT No data
Right 969630822 4:8334962-8334984 GGGTTGTGGCACTATACGATTGG No data
969630810_969630822 27 Left 969630810 4:8334912-8334934 CCTGGCTTCTCTGGAGCCTTGGG No data
Right 969630822 4:8334962-8334984 GGGTTGTGGCACTATACGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630822 Original CRISPR GGGTTGTGGCACTATACGAT TGG Intergenic
No off target data available for this crispr