ID: 969630823

View in Genome Browser
Species Human (GRCh38)
Location 4:8334963-8334985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630810_969630823 28 Left 969630810 4:8334912-8334934 CCTGGCTTCTCTGGAGCCTTGGG No data
Right 969630823 4:8334963-8334985 GGTTGTGGCACTATACGATTGGG No data
969630813_969630823 12 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630823 4:8334963-8334985 GGTTGTGGCACTATACGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type