ID: 969630824

View in Genome Browser
Species Human (GRCh38)
Location 4:8334978-8335000
Sequence CGATTGGGTCTTTCCCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630818_969630824 3 Left 969630818 4:8334952-8334974 CCTGCCCCTGGGGTTGTGGCACT No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data
969630813_969630824 27 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data
969630821_969630824 -3 Left 969630821 4:8334958-8334980 CCTGGGGTTGTGGCACTATACGA No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data
969630819_969630824 -1 Left 969630819 4:8334956-8334978 CCCCTGGGGTTGTGGCACTATAC No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data
969630820_969630824 -2 Left 969630820 4:8334957-8334979 CCCTGGGGTTGTGGCACTATACG No data
Right 969630824 4:8334978-8335000 CGATTGGGTCTTTCCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630824 Original CRISPR CGATTGGGTCTTTCCCAGTC AGG Intergenic
No off target data available for this crispr