ID: 969630825

View in Genome Browser
Species Human (GRCh38)
Location 4:8334979-8335001
Sequence GATTGGGTCTTTCCCAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969630818_969630825 4 Left 969630818 4:8334952-8334974 CCTGCCCCTGGGGTTGTGGCACT No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630819_969630825 0 Left 969630819 4:8334956-8334978 CCCCTGGGGTTGTGGCACTATAC No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630820_969630825 -1 Left 969630820 4:8334957-8334979 CCCTGGGGTTGTGGCACTATACG No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630813_969630825 28 Left 969630813 4:8334928-8334950 CCTTGGGTGAGTGGTCAGTGCTC No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data
969630821_969630825 -2 Left 969630821 4:8334958-8334980 CCTGGGGTTGTGGCACTATACGA No data
Right 969630825 4:8334979-8335001 GATTGGGTCTTTCCCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969630825 Original CRISPR GATTGGGTCTTTCCCAGTCA GGG Intergenic
No off target data available for this crispr