ID: 969631791

View in Genome Browser
Species Human (GRCh38)
Location 4:8343254-8343276
Sequence CTGGATGAGGAGAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969631783_969631791 5 Left 969631783 4:8343226-8343248 CCACTGCGGGTTGGTCTGGGAAC No data
Right 969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969631791 Original CRISPR CTGGATGAGGAGAAGCAGGG AGG Intergenic
No off target data available for this crispr