ID: 969633882

View in Genome Browser
Species Human (GRCh38)
Location 4:8353974-8353996
Sequence GGAACCACCTAAAACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969633874_969633882 2 Left 969633874 4:8353949-8353971 CCTGCTGGCCGGCAGCCCAGGGG No data
Right 969633882 4:8353974-8353996 GGAACCACCTAAAACCTGGAGGG No data
969633872_969633882 3 Left 969633872 4:8353948-8353970 CCCTGCTGGCCGGCAGCCCAGGG No data
Right 969633882 4:8353974-8353996 GGAACCACCTAAAACCTGGAGGG No data
969633877_969633882 -6 Left 969633877 4:8353957-8353979 CCGGCAGCCCAGGGGCTGGAACC No data
Right 969633882 4:8353974-8353996 GGAACCACCTAAAACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969633882 Original CRISPR GGAACCACCTAAAACCTGGA GGG Intergenic
No off target data available for this crispr