ID: 969635634

View in Genome Browser
Species Human (GRCh38)
Location 4:8368120-8368142
Sequence CAGGCCGCACAGGTGGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969635628_969635634 -10 Left 969635628 4:8368107-8368129 CCCCAGGCCGCTACAGGCCGCAC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG 0: 1
1: 0
2: 1
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969635634 Original CRISPR CAGGCCGCACAGGTGGCACG TGG Intronic
900090863 1:919848-919870 CAGGCCGCAGTGTTGGCAGGGGG + Intergenic
900292050 1:1927805-1927827 CTGGCCGCAGAGGAGCCACGGGG - Intronic
900767763 1:4516730-4516752 CAGACAGCACAGGAGGCTCGCGG - Intergenic
901040342 1:6359563-6359585 CAGGGCCCACAGGTGGCAGCCGG - Intronic
901075797 1:6554148-6554170 CGGGCCGCACCGGTGGGATGAGG + Exonic
901239748 1:7686077-7686099 CAGGCAGCCCAGGTGGAAGGAGG - Intronic
901478228 1:9505428-9505450 CTGGCCGCAGAGGTGGCTGGTGG - Intergenic
902649145 1:17825438-17825460 CAGGCTGCACATGTGACCCGTGG + Intronic
903190760 1:21654345-21654367 AAGGTCGCACAGGTGACAAGCGG - Intronic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907722016 1:56980998-56981020 CAGGCTGCACAGGAAGCATGGGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911266880 1:95753606-95753628 GAGGCGGCCAAGGTGGCACGGGG - Intergenic
919851067 1:201673247-201673269 CAGGCCCCACAGATGGGCCGCGG + Intronic
922224880 1:223637472-223637494 CAGGCTGACCAGGTGGCACATGG + Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922724467 1:227915943-227915965 CAGGACACACAGGTGGCCAGAGG - Intergenic
924561175 1:245156870-245156892 CAGGCCGCCCGGGGGGCAGGAGG + Intronic
1062864184 10:835998-836020 CAGGCTGCACTGGTGGCTCAGGG + Intronic
1065183533 10:23150237-23150259 AAGGCTGCACAGCTGGCAAGTGG - Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1068160365 10:53254664-53254686 CAGGCTGCACTGGAGGCACATGG - Intergenic
1069828538 10:71268918-71268940 AAGGACGCAGAGCTGGCACGGGG - Intronic
1070801215 10:79245412-79245434 CAGGCACCACAGTTGGCACTGGG - Intronic
1073452363 10:103617467-103617489 CAGGCCCCAGAGGTGGCAGCAGG + Intronic
1076215019 10:128686558-128686580 CAGGCCACCCAGGTGCCATGGGG + Intergenic
1076893325 10:133295908-133295930 AAGTCTGCACAGGTGGCACAAGG + Intronic
1077043238 11:533714-533736 CACGCCGCACAGGTGGGGCCAGG - Intronic
1077089667 11:772684-772706 CAGCCCGCACAGCTGGCATCAGG + Intronic
1077137525 11:1008430-1008452 CAAGCCGGGCAGGTGGCGCGGGG - Intronic
1077309131 11:1880776-1880798 CAGGCCTCCCATGTGGCAGGGGG - Intronic
1077379178 11:2220675-2220697 CAGGCTGTACAGGAAGCACGGGG + Intergenic
1081595557 11:44456927-44456949 CAGGCAGCAGAGGTGACACCAGG - Intergenic
1081731366 11:45374006-45374028 CAGGGCACACAGTTGGCAAGAGG - Intergenic
1083744072 11:64725678-64725700 GAGGCAGCACAGGAGGCAGGCGG + Intergenic
1083827857 11:65213345-65213367 TTGGCTGCACAGGTGACACGTGG - Intergenic
1084121554 11:67071860-67071882 CAGGCTGCACAGGCGGCTCCAGG - Exonic
1084312582 11:68325489-68325511 CAGGTGGCACAGGTGGCTTGGGG + Intronic
1084834762 11:71794528-71794550 CAGGCCTCAAGGGTGTCACGTGG - Intronic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1089297770 11:117480376-117480398 CAGGCAGGACACGTGGCACAAGG + Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1089796606 11:120986111-120986133 GAGGCCGCCCTGGTGGCCCGCGG + Exonic
1091128086 11:133119816-133119838 CACGTCGCACAGGATGCACGTGG + Intronic
1094355583 12:29574106-29574128 CAGGAAGCAGAGGTGGCAGGTGG + Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1100244119 12:92739347-92739369 CAGGCTGCACATGTGCCATGTGG - Intronic
1102520034 12:113472318-113472340 CAGGGCGCAGAGGGGGCGCGGGG - Intergenic
1102569809 12:113820594-113820616 CAGGCCACACTGGCTGCACGAGG + Intronic
1103005468 12:117417030-117417052 CAGGCATCACAGGTGGCAGGTGG - Intronic
1109140073 13:58703901-58703923 CAGGCGGCACCGGGGGCAGGTGG + Intergenic
1111396386 13:87673059-87673081 CAGGCCGCACCGGAGGCTCCGGG - Intronic
1112439529 13:99415911-99415933 CTGGCAGCAAAGGGGGCACGAGG - Intergenic
1115235750 14:31207485-31207507 CAGGCCGCGCAGGTCGAACCGGG + Intronic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1121327354 14:93028996-93029018 CAGGCCACACAGGGGCCACGGGG - Intronic
1122019587 14:98826588-98826610 CAGGCAGCAGAGTTGGCACCTGG + Intergenic
1122411128 14:101526755-101526777 CAGGCCCCATGGGTGGCAGGTGG + Intergenic
1122436702 14:101705963-101705985 CGGGCCGCAGAGGAGGCTCGGGG - Intergenic
1122798688 14:104219049-104219071 AATGCCTCACAGGTGGCACTGGG - Intergenic
1124028580 15:25989394-25989416 AAGGACGCCCAGGTGCCACGTGG - Intergenic
1131846071 15:96491906-96491928 CAGGCCGCACAGGAGCCCCCGGG + Intergenic
1132240339 15:100252958-100252980 AAGGCCACCCAGCTGGCACGTGG + Intronic
1132573971 16:656368-656390 CAGGAAGCCCAGGTGGCCCGAGG - Exonic
1133017653 16:2951668-2951690 CATGCAGCACAGGTGGCAGAGGG + Intergenic
1133302114 16:4788591-4788613 CAGGCCCCACAGCTGGCTAGCGG + Exonic
1135114328 16:19712553-19712575 AAGGCCACACAGCTGGCAAGAGG - Intronic
1136045256 16:27610183-27610205 CAGGCCCCCCAGGTGGCAGCAGG + Intronic
1136068159 16:27772336-27772358 AAGGCTGCACAGGTGGGAAGGGG + Intronic
1137300524 16:47143992-47144014 CAGGCGGCGCAGCCGGCACGCGG - Exonic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1140412212 16:74748068-74748090 CAGGCCACACAGATGGCCCCGGG + Intronic
1141310660 16:82910663-82910685 CAGGCCGCACAGGTGTTTAGTGG + Intronic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142382761 16:89743014-89743036 CAGGCCCCAAAGGTGACAGGTGG - Intronic
1142612381 17:1116357-1116379 CAGGTCACACAGTTGGCAAGAGG - Intronic
1142985814 17:3694969-3694991 GAGGCCGCTCAGGTGGGAGGCGG + Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1146255789 17:31391155-31391177 TAGGCCACACAGCTGGCAAGAGG - Intergenic
1147622964 17:41880257-41880279 CAGGTCACACAGGTAGCATGTGG + Intronic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1151428079 17:74044093-74044115 AAGGCTGCACAGCTGGCAAGGGG - Intergenic
1151473120 17:74330236-74330258 CAGGCTGCACAGCTGGCAAATGG - Intronic
1157179475 18:45483708-45483730 CAGGCCTCCCTGGTGGCATGAGG - Intronic
1158388899 18:57027075-57027097 CGGGCTGCACAGGGGGCACCTGG - Exonic
1160707582 19:536660-536682 CAGGCGGCACACGTGGCACGAGG - Intronic
1160982220 19:1821663-1821685 CAGCCCCCACAGGTGCCAAGAGG - Exonic
1163509521 19:17726697-17726719 CAGGCCGTCCAGGAGGCAGGCGG - Exonic
1163664453 19:18596743-18596765 CAGGCCGGCCAGGCGGCAGGAGG + Exonic
1164906718 19:31974042-31974064 CAGCCCATAAAGGTGGCACGGGG - Intergenic
1165861840 19:38913153-38913175 TGGGCTGCACAGCTGGCACGTGG - Intergenic
1166214229 19:41325240-41325262 CAGGACGGACAGGAGACACGGGG - Intronic
1166371284 19:42302589-42302611 CAGGCCGCGCACCCGGCACGGGG + Exonic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167213071 19:48145721-48145743 CAGGCCACACAGGTGGGGAGTGG - Intronic
1167589981 19:50399190-50399212 TAGGCCACACAGGCTGCACGGGG - Intronic
1167779728 19:51591149-51591171 CAGGCCCCGGAAGTGGCACGAGG - Exonic
1168324356 19:55530447-55530469 CAGGCCTCACAGGTCACACTAGG - Intronic
1168324370 19:55530504-55530526 CAGGCCTCACAGGTCACACTAGG - Intronic
1168324379 19:55530541-55530563 CAGGCCTCACAGGTCACACTAGG - Intronic
1168324408 19:55530672-55530694 CAGGCCTCACAGGTCACACTAGG - Intronic
1168324417 19:55530709-55530731 CAGGCCTCACAGGTCACACTAGG - Intronic
1168324431 19:55530783-55530805 CAGGCCTCACAGGTCACACTAGG - Intronic
925101338 2:1248824-1248846 CAGGCCACACAGGTAACACATGG - Intronic
926106942 2:10158509-10158531 CAGGCAGCAGAGGTGGCTCAGGG - Intronic
926250253 2:11151707-11151729 CAGGAGGCACAGGTTGCACTGGG - Intergenic
926378099 2:12254607-12254629 AAGGCCACACAGCTGGCAGGTGG - Intergenic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
929087213 2:38180528-38180550 CAGGCCTCACAGCTGGCATATGG + Intergenic
929950349 2:46405430-46405452 AAGGTCACACAGGTAGCACGTGG + Intergenic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
932479930 2:72032971-72032993 CAGGCCACACAGCTGGCAAATGG - Intergenic
937966213 2:127513335-127513357 CAGGCTGCACATGAGGTACGGGG + Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
940124920 2:150311993-150312015 CAGGAGGCACAGGAGGCACAGGG - Intergenic
940242946 2:151582872-151582894 CAGGGCTCACAAGTGGCACTTGG + Intronic
940243901 2:151593424-151593446 CAGGGCTCACAAGTGGCACTTGG + Intronic
940244860 2:151603977-151603999 CAGGGCTCACAAGTGGCACTTGG + Intronic
942328732 2:174798920-174798942 CAAGCCACACAGGTGGCCAGTGG + Intergenic
947212990 2:227724858-227724880 CAGGCCTAACATGTGGCAGGTGG + Intergenic
948365831 2:237453884-237453906 CCTGCCACACAGGTGGCACATGG - Intergenic
948384646 2:237573990-237574012 CAGGCTGCACAGGATGCACAGGG - Intergenic
948689795 2:239694686-239694708 CAGGCTGCCCAGGAGGCATGAGG + Intergenic
948884010 2:240874107-240874129 CAGGGAGCTCAGGTGGCCCGAGG + Intronic
1170575014 20:17655885-17655907 CTGGCCCCACATGTGGTACGTGG + Intronic
1172505814 20:35461629-35461651 CAGGCCACACAGCTGGCATATGG - Intronic
1173999358 20:47363031-47363053 AAGGCCGCACAGCTGGCAAGTGG - Intergenic
1174799844 20:53554039-53554061 CAGGCTGCAGAGGTGGCAACAGG - Intergenic
1178716098 21:34965884-34965906 CAGGCCACACAGGTGTCACCAGG - Intronic
1179716765 21:43292418-43292440 GAGGCCGGAGGGGTGGCACGAGG - Intergenic
1180169495 21:46050512-46050534 CAGCCCTCCAAGGTGGCACGGGG + Intergenic
1180192310 21:46171538-46171560 CAGGCCTCCCACGTGGCAGGAGG - Intronic
1181808966 22:25392028-25392050 CAGGTGGCACAGGTGGCTTGGGG - Intronic
1183058101 22:35319319-35319341 CAGGCAACACAGGAGGCACTAGG + Intronic
1185014120 22:48333565-48333587 CAGGCGGGACAGGTAGCACTGGG + Intergenic
1185213839 22:49587380-49587402 CAGGCCTCAGATGAGGCACGAGG + Intronic
1185419064 22:50725325-50725347 TAGGCCACTCAGGTGGCACCAGG - Intergenic
954579836 3:51697233-51697255 CTGGCAGAACAGGTGGCACAGGG + Intronic
957714993 3:83916309-83916331 ATGGCAGCACAGGTGGCAAGAGG + Intergenic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
961301236 3:125923483-125923505 CAGGCCTCAAGGGTGTCACGTGG - Intergenic
962631389 3:137279731-137279753 AAGGTCACACAGGTGGCAAGTGG + Intergenic
968616592 4:1580365-1580387 CTGGCCACACTGGTGGCCCGCGG - Intergenic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
971735184 4:30439899-30439921 AAGGCCACACATCTGGCACGAGG + Intergenic
972162180 4:36240503-36240525 AAGGCCACACAGGTAGCACATGG - Intronic
973706696 4:53588429-53588451 CAGGTCACACAGGTAGCACATGG + Intronic
975720041 4:77240573-77240595 CAGGCAGTACAGGTGGGCCGTGG + Intronic
981107272 4:140895152-140895174 CAGGGGGCACAGGTAGCATGAGG + Intronic
986183799 5:5418078-5418100 CTGGCAGGAGAGGTGGCACGTGG + Intergenic
994092058 5:95818278-95818300 CAGGCTGTACAGACGGCACGGGG + Intronic
996547199 5:124692731-124692753 CAGGCAGCACACCTGGCAAGTGG - Intronic
997065012 5:130549486-130549508 GAGGCAGCAGAGGTGACACGGGG - Intergenic
997673322 5:135694200-135694222 CAGGCCGCCCAGGAGACCCGTGG - Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
1000925107 5:167184703-167184725 CAGGCAGCACAGATGGGATGAGG - Intergenic
1001042670 5:168348191-168348213 CCGGCCACACAGCTGGCAAGTGG + Intronic
1001490952 5:172154770-172154792 CAGGCCACACAGCTAGCAAGTGG - Intronic
1001561459 5:172671935-172671957 AAGGCCACACAGCTGGCAAGTGG - Intronic
1002279785 5:178123518-178123540 CAGGCCCCACAGGTGGGTCCTGG + Exonic
1002409066 5:179060198-179060220 CACGCCGCACACGAGGCAGGAGG - Intergenic
1004000261 6:11591352-11591374 CAGGCCGCACAGGCCGGGCGTGG - Intergenic
1007252982 6:40509017-40509039 CAGACCTCACAGGTGGAAGGAGG - Intronic
1007321807 6:41033215-41033237 GAGGCCCCTCAGGTGGCAGGAGG - Intronic
1007424048 6:41735466-41735488 CGGGCCTCCCTGGTGGCACGGGG - Intronic
1013279834 6:108625729-108625751 AAGGCCACACAGCTGGCAGGTGG - Intronic
1017908610 6:158773676-158773698 CTGGCCGCAGAGATGGCAGGAGG + Intronic
1019413090 7:915049-915071 CAGGTCGCGCAGGAGGCACCAGG - Intronic
1019543304 7:1560971-1560993 CAGGAGGCAGGGGTGGCACGTGG - Intergenic
1020143092 7:5623018-5623040 CAGGCCGCACGGGAGGCAGGGGG + Exonic
1020281545 7:6652630-6652652 CTTGCCGCACACGTCGCACGTGG - Exonic
1022257287 7:28671747-28671769 AAGGTCACACAGCTGGCACGTGG - Intronic
1022598991 7:31738773-31738795 CAGGTGACACAGGTGGCACCTGG - Intergenic
1023221148 7:37921016-37921038 CAGGCTGCACAGGCCGCACAGGG - Exonic
1024232639 7:47374339-47374361 CCAGCCTCACAGGTGGCAGGAGG - Intronic
1026806375 7:73431889-73431911 CAGGCCACACAAGGGGCAAGGGG - Intergenic
1029128009 7:98308516-98308538 CAGACCCCACAGCTGGCAAGTGG + Intronic
1029457460 7:100678441-100678463 CAGGTCGAAGAGGCGGCACGTGG - Exonic
1031418781 7:121524456-121524478 ATGGCTGCACAGGTGCCACGTGG + Intergenic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1035428139 7:158795911-158795933 AAGGCTGCACAGGAGGCACGGGG + Intronic
1035768677 8:2129281-2129303 CAGGGCGCACAGCTGGGACCAGG + Intronic
1036620400 8:10421449-10421471 CTGGCAGCACAGGTGGCAGTGGG - Intronic
1036663253 8:10721902-10721924 CAGGGCACACAGGTAGCACCAGG - Intergenic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1042733370 8:71961644-71961666 CAGGCACCACAGGAGGCACAGGG - Intronic
1049173496 8:141176810-141176832 CAGGACCCACAGGTGGCGAGAGG - Intronic
1049556092 8:143282976-143282998 CAAGCCCCACAGGAGGCCCGGGG + Intergenic
1049559713 8:143303639-143303661 CAGGCCTCACCAGTGCCACGAGG + Intergenic
1052901840 9:33800139-33800161 CAGGTGTCACAGGTGTCACGGGG - Intergenic
1053273262 9:36764888-36764910 CAGGTGGCGCAGGTGGCAGGTGG + Intergenic
1055127060 9:72730997-72731019 CAGGCCACACAGCAGGCAAGTGG - Intronic
1057216253 9:93230448-93230470 CAGGCCACACAGGTGGCCAGTGG + Intronic
1060039482 9:120287399-120287421 AAAGCCACACAGCTGGCACGTGG - Intergenic
1062538413 9:137030945-137030967 AAGGCCTCATAGGTGGCCCGTGG + Exonic
1062716877 9:138015146-138015168 CAGCCCTCACACGTGGCAAGGGG + Intronic
1185477898 X:425910-425932 GAGGCCGCAGAGCTGGCAGGAGG - Intergenic
1187697822 X:21939229-21939251 CTGGCAGCACAGGTGGCCCTCGG - Intergenic
1199400160 X:147389664-147389686 CATGCCAGCCAGGTGGCACGGGG - Intergenic
1201243240 Y:11979020-11979042 CAGGCCGTACAGGTTGCTGGCGG - Intergenic