ID: 969640341

View in Genome Browser
Species Human (GRCh38)
Location 4:8394614-8394636
Sequence ACCGCAGCGCCAGACAGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969640341_969640346 12 Left 969640341 4:8394614-8394636 CCTCACCTGTCTGGCGCTGCGGT 0: 1
1: 0
2: 0
3: 7
4: 84
Right 969640346 4:8394649-8394671 GTCCTCGCTGGAGCTCCACCAGG 0: 1
1: 0
2: 0
3: 8
4: 129
969640341_969640343 0 Left 969640341 4:8394614-8394636 CCTCACCTGTCTGGCGCTGCGGT 0: 1
1: 0
2: 0
3: 7
4: 84
Right 969640343 4:8394637-8394659 CTCCCGATGCAAGTCCTCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 36
969640341_969640348 18 Left 969640341 4:8394614-8394636 CCTCACCTGTCTGGCGCTGCGGT 0: 1
1: 0
2: 0
3: 7
4: 84
Right 969640348 4:8394655-8394677 GCTGGAGCTCCACCAGGTCCAGG 0: 1
1: 0
2: 3
3: 35
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969640341 Original CRISPR ACCGCAGCGCCAGACAGGTG AGG (reversed) Exonic
900126934 1:1072880-1072902 GCAGCAGGGCCAGCCAGGTGGGG - Intronic
900323440 1:2095949-2095971 ACAGCAGAGTCAAACAGGTGAGG - Intronic
900544302 1:3219973-3219995 ACCTCAGCGCCAAACATCTGTGG - Intronic
905392241 1:37644212-37644234 ACAGCAGAGCAAGACAGCTGAGG + Intergenic
905560875 1:38926357-38926379 ATCACAGAGCCAGATAGGTGAGG - Exonic
906654409 1:47537279-47537301 AACGCAGACCCAGCCAGGTGTGG - Intergenic
912431539 1:109630702-109630724 ACAGCATCGCCACCCAGGTGTGG + Exonic
915520183 1:156437262-156437284 ACCCCATCCCCGGACAGGTGGGG + Intergenic
918012517 1:180601301-180601323 ACCGCAGAGCCAAACAGTTCAGG + Intergenic
922704088 1:227779869-227779891 CACGCAGGGCCAGGCAGGTGTGG - Intronic
1062919204 10:1266482-1266504 ACCACAGCGCCAATGAGGTGGGG - Intronic
1063467175 10:6254334-6254356 GCCGCAGAGCCAGAAAGGTGAGG - Intergenic
1067177225 10:43958565-43958587 ACTGCAGGGACAGAGAGGTGGGG + Intergenic
1076247523 10:128958931-128958953 CACGCAGCGCCAGACAAGAGAGG + Intergenic
1076919498 10:133444400-133444422 ACCTCAGCACCTCACAGGTGAGG - Intergenic
1077895652 11:6451354-6451376 GCTGCAGCGCCCCACAGGTGTGG - Exonic
1078902411 11:15653706-15653728 ACCTCAAATCCAGACAGGTGTGG - Intergenic
1084156794 11:67317682-67317704 CCCGCAGCGCCCGGCAGCTGGGG + Intergenic
1090029131 11:123193064-123193086 ATCGAAGAGCCAGCCAGGTGTGG + Intronic
1092225568 12:6746119-6746141 ACCCCAGTGGCAGACAGGTCAGG + Intergenic
1093272013 12:17075157-17075179 AACACAGCACCAGCCAGGTGTGG - Intergenic
1094222777 12:28012477-28012499 CCCACACCGCCAGACATGTGGGG - Intergenic
1095810650 12:46371407-46371429 ACCGCAGCGCCAGCCCGCCGCGG + Intronic
1101357259 12:103992103-103992125 ACCGCTGGGCCAGACATGTTTGG - Intronic
1104342239 12:127961285-127961307 ACTGCAGCCTCAGACAGCTGGGG + Intergenic
1104980869 12:132572625-132572647 ACCGCTGCCCCTGGCAGGTGGGG + Intronic
1106460530 13:29964013-29964035 GCCACAGCCCCAGGCAGGTGAGG + Intergenic
1107821691 13:44291684-44291706 ACAGCAGGGCCAGATTGGTGTGG - Intergenic
1119261778 14:73241973-73241995 AGCGCAGCATGAGACAGGTGAGG + Intronic
1122721090 14:103723064-103723086 CCCACAGCGCCCGACAGGAGGGG - Intronic
1122996864 14:105269801-105269823 ACCCCAGCGTCAGCAAGGTGGGG - Intronic
1127849522 15:62900931-62900953 ACCCCAGCCCCAGACTGCTGTGG - Intergenic
1132573096 16:652519-652541 GCCACGGCACCAGACAGGTGAGG + Exonic
1142275915 16:89118866-89118888 AGCGCAGCTGCAGGCAGGTGGGG - Intronic
1142290320 16:89191271-89191293 ACCCCAGGGCCCCACAGGTGTGG - Intronic
1144680186 17:17188112-17188134 GCCCCAGCCCCAGGCAGGTGTGG + Exonic
1144948450 17:18981636-18981658 ACCACAGAGGCAGGCAGGTGTGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148850201 17:50550901-50550923 ACATCAGCCCCAGTCAGGTGAGG + Exonic
1150123099 17:62619457-62619479 GACGTAGAGCCAGACAGGTGGGG + Intergenic
1151415299 17:73958209-73958231 GCCGCTGAGCCCGACAGGTGTGG + Intergenic
1159963483 18:74574185-74574207 ACAGCAGAGACAGAGAGGTGAGG - Intronic
1161310650 19:3592269-3592291 ACCACAGCCCCAGACAGCTCTGG + Exonic
1163502941 19:17687169-17687191 ACCCCAGAGCCATAAAGGTGTGG + Intronic
1167796117 19:51709977-51709999 AGCGCAGCACCAGCCACGTGTGG + Intergenic
927645863 2:24876640-24876662 TCCCCAGGGCCAGGCAGGTGTGG + Intronic
928013072 2:27628950-27628972 ACCACAGCGTCAGAAAGGAGCGG - Intronic
930257943 2:49113175-49113197 ACAGCACCTCCAGACATGTGGGG + Intronic
931840729 2:66145382-66145404 AACGCAGAGCCAGACAGGGAAGG - Intergenic
932313958 2:70767598-70767620 AGCGTAACGCCTGACAGGTGGGG - Intronic
937230225 2:120394153-120394175 ACTGCAGGGCCAGACACGTTGGG + Intergenic
937982129 2:127622080-127622102 CCTGCAGCTCCAGCCAGGTGGGG - Exonic
946038758 2:216765972-216765994 ACCCCAGAGCCAGCCAGGAGTGG - Intergenic
947587261 2:231364215-231364237 AGAGCAGCCCCAGCCAGGTGTGG + Intronic
1170732447 20:18986742-18986764 ACCTCAGCGCCAGGCAGCTGAGG - Intergenic
1172961634 20:38804684-38804706 ACCCCAGGGCCAGCCAGCTGGGG - Intergenic
1174378698 20:50142740-50142762 ATAGCAGCCCCAGCCAGGTGTGG - Intronic
1174972775 20:55295727-55295749 ACTTCAGAGCCAGACAGCTGAGG + Intergenic
1175419108 20:58820217-58820239 ACCGCTGAGCCACACAGGTGGGG + Intergenic
1178257194 21:31065037-31065059 ACCACAGCCCCACCCAGGTGTGG + Intergenic
1181639243 22:24188119-24188141 CCCGAAGTGCCAGCCAGGTGAGG + Exonic
1185272198 22:49934786-49934808 ACCGCAGCCCCAGGGAGGCGGGG - Intergenic
968461252 4:726123-726145 GCCGCAGCGCCACACAGGCCAGG - Intronic
969640341 4:8394614-8394636 ACCGCAGCGCCAGACAGGTGAGG - Exonic
971902790 4:32683254-32683276 ATCACAGGGCCAGACAGGTGAGG - Intergenic
975577423 4:75876713-75876735 ACTGTAGGCCCAGACAGGTGTGG + Intronic
983509192 4:168589281-168589303 CCCTCAGGGCCAGACAGGTGTGG + Intronic
985642018 5:1067922-1067944 ACTGCTGCGCCGGGCAGGTGCGG - Intronic
986041665 5:3999818-3999840 ACCACAGAGCCCGACAGGTGGGG + Intergenic
997953090 5:138257667-138257689 GCCGCAGCTCCAGGCAGTTGGGG + Exonic
998472405 5:142393355-142393377 ACCACAGGTCCAGAAAGGTGGGG - Intergenic
999710981 5:154318145-154318167 ACCCCAGCCCTATACAGGTGAGG + Intronic
1002023591 5:176382169-176382191 ACCACAGAGCCAGTTAGGTGAGG - Intronic
1010585576 6:77654299-77654321 ACCACAGTGCCTGACAGGTTGGG + Intergenic
1017842658 6:158233554-158233576 TCCGCAGCGCCAGATTGCTGGGG + Intronic
1019354735 7:572572-572594 ACCCCAGCCCCGCACAGGTGTGG - Intronic
1024995947 7:55273358-55273380 ACCCCAGCGTCAGACAGGATCGG + Intergenic
1032576494 7:133060418-133060440 ACCACAGGCCCACACAGGTGGGG + Intronic
1034449586 7:151130124-151130146 AGGGCAGCTCCACACAGGTGGGG - Intronic
1035044900 7:155957289-155957311 ACAACAGGGCCAGACAGGTGTGG + Intergenic
1042246408 8:66712821-66712843 ACCGCGGGGCCAGGTAGGTGCGG + Intronic
1049389662 8:142361204-142361226 ACAGCAGCTCCAGACAGGCCTGG + Intronic
1056768077 9:89457227-89457249 AAACCAGCGCCTGACAGGTGGGG + Intronic
1057546445 9:96022617-96022639 CCCGCAGCGCCAGCCGGGTCCGG + Intergenic
1057690129 9:97276526-97276548 AATGCAGCTCCAGGCAGGTGGGG - Intergenic
1058594162 9:106597286-106597308 ACAGAAGGGCCAGAAAGGTGAGG + Intergenic
1060898750 9:127238786-127238808 AACGCAGCACCGGACAGATGAGG - Intronic
1061793525 9:133071131-133071153 TGGGCAGCGCCAGATAGGTGAGG - Exonic
1061796134 9:133086930-133086952 TGGGCAGCGCCAGATAGGTGAGG - Intronic
1061948153 9:133920317-133920339 ACAGCAGTGCAAGACAGCTGAGG + Intronic
1187257733 X:17657073-17657095 ACAGGTGCGCCAGAGAGGTGGGG - Intronic
1189035370 X:37489652-37489674 ACCCCAGAGCCAGTCAGCTGTGG - Intronic