ID: 969642216

View in Genome Browser
Species Human (GRCh38)
Location 4:8405672-8405694
Sequence AGACCTCTGTGTACAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969642216_969642220 -2 Left 969642216 4:8405672-8405694 CCACCAGTTGTACACAGAGGTCT 0: 1
1: 0
2: 0
3: 12
4: 120
Right 969642220 4:8405693-8405715 CTGGGTCTGATCTGAGAGTGTGG No data
969642216_969642221 13 Left 969642216 4:8405672-8405694 CCACCAGTTGTACACAGAGGTCT 0: 1
1: 0
2: 0
3: 12
4: 120
Right 969642221 4:8405708-8405730 GAGTGTGGAGCCGCCTGCCAAGG No data
969642216_969642222 22 Left 969642216 4:8405672-8405694 CCACCAGTTGTACACAGAGGTCT 0: 1
1: 0
2: 0
3: 12
4: 120
Right 969642222 4:8405717-8405739 GCCGCCTGCCAAGGTGAAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969642216 Original CRISPR AGACCTCTGTGTACAACTGG TGG (reversed) Intronic
900710786 1:4112276-4112298 AGTCCTCTGTGTGCCACTGAAGG - Intergenic
901784911 1:11618113-11618135 AGACCTTTGTGGAAAATTGGTGG + Intergenic
905514240 1:38550196-38550218 AGACCACTGTGGACATCTGGGGG + Intergenic
910697269 1:90032668-90032690 AGAGCTGTCTCTACAACTGGAGG - Intronic
913017928 1:114757895-114757917 CGACCTCAGGGTCCAACTGGGGG - Intronic
919785311 1:201254793-201254815 AGACCTCTGGGGACAACCTGGGG + Intergenic
921504113 1:215945492-215945514 AGACCTGTTAATACAACTGGTGG - Intronic
924763673 1:247011703-247011725 AGACCTCTGTGCACTGCTAGTGG - Intergenic
1063115774 10:3070258-3070280 GGCCCTCTGAGTACATCTGGAGG - Intronic
1064272377 10:13877478-13877500 GGACCTCCGTGTAGGACTGGTGG - Intronic
1066279327 10:33899691-33899713 AGAGCTGTCTGTCCAACTGGAGG - Intergenic
1067056667 10:43056607-43056629 CCCCCTCTGTGCACAACTGGTGG + Intergenic
1069800089 10:71076602-71076624 AGAGCTCTGTGTGTAGCTGGAGG - Intergenic
1070986833 10:80696578-80696600 AAACCCCTGTGAACAAATGGTGG - Intergenic
1075300425 10:121317557-121317579 AAACCTTTGTGTCCTACTGGTGG - Intergenic
1076004468 10:126937447-126937469 AAACCCCTGTGTACTAGTGGTGG - Intronic
1081295771 11:41387249-41387271 AGTCCTCTGAGGACAAATGGAGG + Intronic
1082761466 11:57130980-57131002 AGACCTCTGCCTACTCCTGGTGG - Intergenic
1083032491 11:59605868-59605890 TGACCTATGTGTATAACTTGGGG - Intronic
1083811865 11:65110865-65110887 AGGACTCTGTGACCAACTGGGGG + Intronic
1083873800 11:65509104-65509126 AGGTCCCTGTGTACAACTGGAGG - Intergenic
1088645587 11:111913796-111913818 TGACCTCTGTGTCCAAATGTCGG - Exonic
1089736829 11:120555532-120555554 CGACCGCTGTGTGCATCTGGTGG - Intronic
1091684848 12:2554489-2554511 AGAACTCTGAGAACAGCTGGGGG - Intronic
1093910132 12:24737812-24737834 AGATCTCTGTTTTCAACTGGGGG + Intergenic
1096117464 12:49063544-49063566 AGACCTCTTCTGACAACTGGGGG - Intergenic
1097206155 12:57322884-57322906 AGGCCTCTGAGTACCAGTGGGGG + Intronic
1101841447 12:108330449-108330471 AGACATCTGGGTTCAACTAGAGG + Intronic
1103208450 12:119149029-119149051 AGACTTCTCTGTAAATCTGGGGG + Intronic
1109055206 13:57538502-57538524 AGACTTCTGTGAAGAACTAGAGG + Intergenic
1115857491 14:37646503-37646525 AGACCTCTGTGGACAATTTCAGG + Intronic
1119636899 14:76280497-76280519 AGACCTGTGTGTACATGTGAGGG + Intergenic
1123681223 15:22765632-22765654 AGGGCTCTGTGTCCAGCTGGGGG + Intergenic
1124333434 15:28840094-28840116 AGGGCTCTGTGTCCAGCTGGGGG + Intergenic
1126961408 15:54000567-54000589 AGACCTCTGTGAAGAACAAGAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1129273479 15:74431597-74431619 AGAGCTCTGTCTACCAGTGGTGG - Intronic
1133365919 16:5210107-5210129 AGACCTCTCTGTATAACTCCAGG + Intergenic
1134266864 16:12700393-12700415 AGACCTCTGTGTTCAACACGTGG - Intronic
1139175129 16:64678156-64678178 ATGGCTCTGTGGACAACTGGAGG + Intergenic
1139539016 16:67599915-67599937 AGACCTCTGTGTAGAAACAGTGG + Intronic
1143191713 17:5044800-5044822 AGGCTCCTGTGTCCAACTGGAGG - Intronic
1143990507 17:10956236-10956258 AGGTCTTTGTTTACAACTGGGGG + Intergenic
1150718685 17:67595590-67595612 AGAGCCCTGTGTACAAGTAGGGG - Intronic
1154975393 18:21452514-21452536 AGTCCTCTGGGCACAGCTGGTGG - Intronic
1155673506 18:28401045-28401067 TGACCTTTGTGTTCAAATGGAGG + Intergenic
1156324422 18:36061108-36061130 AGACCTCTTTGAACAAGTTGCGG - Intronic
1157207107 18:45710116-45710138 AAACCCCTGTGTACTCCTGGGGG - Intergenic
1157519418 18:48335048-48335070 AGACCTGTGTGGTCAGCTGGAGG - Intronic
1160307228 18:77751324-77751346 AGACCTCAGTGTTCAGCTTGCGG - Intergenic
1161456529 19:4372469-4372491 AGACCTCTGTGCAAAACAGCTGG + Intronic
1161533490 19:4804280-4804302 AGAGCTCTGAGCACTACTGGTGG + Intergenic
928751613 2:34477055-34477077 AGACCTCTGTCTAGATATGGAGG + Intergenic
930748169 2:54906138-54906160 GAACCCTTGTGTACAACTGGTGG - Intronic
937874503 2:126811322-126811344 AGACCTCTGTGGATATTTGGTGG - Intergenic
942256324 2:174102917-174102939 AGTCTTCTGTGTACAAATGAAGG - Intronic
942499003 2:176568584-176568606 AGACCCCTGGGTACCACTGAGGG - Intergenic
944152701 2:196577699-196577721 AGAGCTCTGTGTACATGTTGGGG - Intronic
1168847039 20:952391-952413 AGAGCTCTATGTGCAGCTGGCGG - Intergenic
1170574021 20:17649250-17649272 ACACCTCTCTGTGCAACTGCCGG + Intronic
1171399922 20:24866282-24866304 GTACCTCTCTGTACAGCTGGTGG + Intergenic
1171974265 20:31584094-31584116 AGACATCTGTGAACAACAAGTGG - Intergenic
1173154306 20:40594919-40594941 AAACCTATGTGGACAACTTGAGG - Intergenic
1175782868 20:61694679-61694701 ACACCCCTGTGTCCAACTGTGGG - Intronic
1177006394 21:15677496-15677518 AGACATCTGTGTACATCTGTGGG - Intergenic
1177993694 21:28069770-28069792 AGACCTTTGTGTACGAATGTGGG + Intergenic
1178819546 21:35962725-35962747 AGACACCTGTGTACCAGTGGTGG - Intronic
1179710255 21:43209266-43209288 AGACCTCTGCGTCCAGGTGGTGG + Intergenic
1181628621 22:24138242-24138264 AGACTTCTGTGACCAAATGGGGG + Intronic
1184829701 22:46976773-46976795 AGAACGCTGGGAACAACTGGTGG - Intronic
1184841281 22:47053613-47053635 AGGCCTCTGTGCACAGCAGGAGG + Intronic
950915701 3:16642938-16642960 AGATCACTGTGTTCAACTGGAGG - Intronic
951702661 3:25511787-25511809 TGAACTCTGTGCACAACTTGAGG + Intronic
952647750 3:35682146-35682168 AGCCCTCTATGTACACCTTGAGG - Intronic
952722409 3:36546872-36546894 AGTCCTCTGAGTACATCTGGTGG + Exonic
957643717 3:82891012-82891034 GGAGCTCTGTGTACAACGGCAGG + Intergenic
959055800 3:101566693-101566715 AGACCTCTGTGACCAAATGTCGG - Intergenic
964700825 3:159564245-159564267 AGTCCTAAGTGTACAGCTGGAGG + Intronic
965206110 3:165720439-165720461 TGAGGTCTGTGAACAACTGGAGG + Intergenic
969642216 4:8405672-8405694 AGACCTCTGTGTACAACTGGTGG - Intronic
975264915 4:72352211-72352233 ATACCACTGTATACCACTGGTGG - Intronic
976213453 4:82693753-82693775 GGACCTCTGTGTCCGTCTGGGGG - Intronic
976610901 4:87029338-87029360 AAACCTCTGTCTTCAAATGGAGG - Intronic
977583194 4:98747065-98747087 AGACCTCCATGTTCAACTGAAGG + Intergenic
978147371 4:105391553-105391575 ATACCTCTATGTAGAACTGGAGG - Intronic
981510991 4:145558041-145558063 TGACCTCTGTGACCAACTGTTGG + Exonic
986244916 5:5998447-5998469 AGACAGCTGTGTAGAGCTGGAGG - Intergenic
986392212 5:7297626-7297648 AGGGCTCTGTGTCCAGCTGGGGG + Intergenic
987615444 5:20268091-20268113 AGCCATATGTGTGCAACTGGAGG - Intronic
990663318 5:58043274-58043296 AGGCCTCTAGGTACAACTGCAGG - Intergenic
992499199 5:77325056-77325078 AGACCACTGTAACCAACTGGAGG + Intronic
993304080 5:86253350-86253372 TGACCTCTTTGTAGTACTGGAGG - Intergenic
1001701232 5:173707819-173707841 AAACCACGGTGTACAACTGCTGG - Intergenic
1001835339 5:174826546-174826568 AGTCCTCTGTGGTAAACTGGTGG + Intergenic
1003129368 6:3382055-3382077 AGAGCTCTAAGTACAAGTGGAGG - Intronic
1003192868 6:3889622-3889644 AGACTTCTGTGAACAAATGCGGG - Intergenic
1003486794 6:6587076-6587098 AGAGCTCTCTTTACAACTGCTGG + Intergenic
1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG + Intergenic
1016604971 6:145910139-145910161 AGACCTCTGTCTACTTGTGGTGG + Intronic
1016702237 6:147067033-147067055 ACACCTCTTTGTACAAGGGGAGG + Intergenic
1018056785 6:160059037-160059059 AGCCCTCTGTGGACAGCTGGAGG - Exonic
1021509641 7:21421844-21421866 ACACCTCTGTGTACTGCTTGTGG + Intergenic
1024258781 7:47558779-47558801 ATTCCTCTGTGTACACCTGCAGG + Intronic
1027743928 7:82049569-82049591 TTAACTGTGTGTACAACTGGCGG - Intronic
1030164103 7:106535734-106535756 AGATCTCTGTGTATCACTAGGGG - Intergenic
1031408993 7:121420142-121420164 AGCCCTCTTAGCACAACTGGAGG + Intergenic
1032504681 7:132426127-132426149 GGAGATCAGTGTACAACTGGAGG + Intronic
1034816357 7:154175368-154175390 AGGACTCAGTGTGCAACTGGTGG + Intronic
1038033814 8:23669296-23669318 AGACCTTTGAGTACTACAGGAGG - Intergenic
1038602889 8:28965531-28965553 AGGCCTCTGTGTTCAAGTGAAGG + Intronic
1044455480 8:92388004-92388026 AGACCTCAGTCTACAACAAGTGG - Intergenic
1045815616 8:106272532-106272554 AGAACTCTGTGGAAAACTGTTGG + Intronic
1047224543 8:122945229-122945251 AGAACCCTGTGGACAGCTGGGGG - Intronic
1047478538 8:125258572-125258594 AGCATTCTGTGTGCAACTGGAGG + Intronic
1052965673 9:34338829-34338851 TGACCTTTGTGTATAACTGCAGG - Exonic
1055082969 9:72285325-72285347 AGACCTATGTGTGTAACAGGAGG + Intergenic
1055189543 9:73500497-73500519 AAACCTCTGTGTACAAAAGTAGG + Intergenic
1057102790 9:92378923-92378945 AGACCTCTGCCTATAACTTGTGG - Intronic
1058270626 9:102967822-102967844 TGATGTCTGTGTACATCTGGCGG + Intergenic
1059187828 9:112292310-112292332 AAACCCCTGTGTACCACTGGTGG + Intronic
1059590274 9:115651536-115651558 AGAGCTCTGGGTATAGCTGGAGG + Intergenic
1059897100 9:118878622-118878644 AAATCTCTGTGTAACACTGGGGG - Intergenic
1186457802 X:9723851-9723873 AGACATCAGTTTACAAATGGTGG + Intergenic
1187106738 X:16251078-16251100 AGACCACTGTGTAAAACTTAGGG - Intergenic
1188385945 X:29558148-29558170 AGACCTCTGTGCACTGATGGTGG - Intronic
1192429023 X:71100289-71100311 AGACTTCTCTGTACAGCGGGTGG - Intronic
1192845253 X:74900544-74900566 AAACCCTTGTGTACTACTGGTGG + Intronic
1194816510 X:98448047-98448069 AGACCTTTGTATACACCTTGAGG - Intergenic
1195596269 X:106693777-106693799 TTACCTGTGTGTACAGCTGGAGG + Intronic
1197563123 X:128048218-128048240 AGATCTCTGTGTTAATCTGGAGG + Intergenic
1198736703 X:139793137-139793159 AGACTTCTGTGTCCAAATGTGGG - Intronic
1199054343 X:143274970-143274992 AGACCTCTGTTTCCAACTGCTGG - Intergenic
1199477219 X:148259099-148259121 AGTCCTCTTTGTACCTCTGGTGG + Intergenic