ID: 969644536

View in Genome Browser
Species Human (GRCh38)
Location 4:8419818-8419840
Sequence GGTGACTGGCAGTGTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969644536_969644543 16 Left 969644536 4:8419818-8419840 CCAGTTCCACACTGCCAGTCACC 0: 1
1: 0
2: 2
3: 22
4: 175
Right 969644543 4:8419857-8419879 TACAAACCCCAGTGTCATGTTGG 0: 1
1: 0
2: 0
3: 7
4: 127
969644536_969644539 -10 Left 969644536 4:8419818-8419840 CCAGTTCCACACTGCCAGTCACC 0: 1
1: 0
2: 2
3: 22
4: 175
Right 969644539 4:8419831-8419853 GCCAGTCACCCAAGGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969644536 Original CRISPR GGTGACTGGCAGTGTGGAAC TGG (reversed) Intronic
900405612 1:2491700-2491722 GGTGACAGGCAGGGTGGGCCGGG + Intronic
901906534 1:12416959-12416981 GGTGACTGGAGGTGAGGAAAAGG - Intronic
902550684 1:17217383-17217405 GGTGACTGTCACTGGGGAAAAGG - Intronic
902759886 1:18574295-18574317 AGTGATTAGCAGTGTGGACCTGG + Intergenic
902794174 1:18790080-18790102 GGTGACTGGCAGGAGGGATCGGG + Intergenic
903572874 1:24319272-24319294 GGGGACTGGCTGGGTGGAGCTGG - Intergenic
905182695 1:36176618-36176640 GGGGACAGGCAGCCTGGAACTGG + Intronic
905904704 1:41610268-41610290 GGTGACTGGCTGAGTGTAAGGGG - Intronic
907657349 1:56357641-56357663 AGTGACTGCCAGTGTGGAAGAGG - Intergenic
909979147 1:82077671-82077693 GGTCACTGGCAGAGTGCAATGGG + Intergenic
914690642 1:150022981-150023003 GATCACTGGCAGTGTAGAACTGG + Intergenic
915040948 1:152967875-152967897 TGTGTCTGGCAGTGTGAGACAGG + Intergenic
919905942 1:202078374-202078396 TGTGACTGGCAGGGTGGGGCAGG - Intergenic
921289924 1:213647979-213648001 AGTGAATGTCAGTGTGGAGCAGG - Intergenic
921796278 1:219348210-219348232 CGTGGCTGGCACTGTGGAAGTGG - Intergenic
922236286 1:223725038-223725060 GGTGTCTGGCAGTTAGGGACTGG + Intronic
1062938767 10:1406711-1406733 GGTGAGTGCCAGGGTGGATCTGG + Intronic
1067729107 10:48796366-48796388 AGTGGCTGGCACTGTGGAGCTGG + Exonic
1068010862 10:51448805-51448827 TGTGACTGTCAGTGTTGCACTGG + Intronic
1070496134 10:77024942-77024964 GGTCACTGGGAATGTGGAAGTGG + Intronic
1071411264 10:85399339-85399361 GGTGATGGGGAGTGTGTAACTGG + Intergenic
1074598502 10:114889535-114889557 AATGACTAGCAGTGTGGAAGAGG - Intronic
1075411690 10:122233242-122233264 GGTCACTGGAAATGTGGTACAGG + Intronic
1075498090 10:122945264-122945286 TATGACTGGCAGTGTGCAATCGG - Intronic
1075819280 10:125291833-125291855 CGTGACTGGCAGTCAGGAATGGG - Intergenic
1076798696 10:132810928-132810950 GGTGCCTGGCTGCCTGGAACGGG - Exonic
1077724599 11:4661527-4661549 GGTGATGGGCAGTGTGGACAAGG + Intergenic
1077958328 11:7045951-7045973 AGTGAGTGGCAGTGTTGAATTGG + Intronic
1083196041 11:61088277-61088299 TGTGACTGTCAGTGTGGAAGAGG - Intergenic
1083988274 11:66231112-66231134 GCTTACTGCCAGTGTGGAACTGG + Intronic
1084966856 11:72749361-72749383 GGTTATTGGCAGGGTGGAATTGG + Intronic
1085172837 11:74463464-74463486 GGGGACTGGCAGTCAGCAACAGG + Intronic
1086269462 11:85043877-85043899 GGTTTATGACAGTGTGGAACTGG - Intronic
1089271432 11:117304116-117304138 TGTGACTGGCTGTGGGCAACAGG + Intronic
1089551319 11:119281156-119281178 GGTGACAAGTAGTGTGGCACAGG - Intronic
1094752565 12:33428922-33428944 AAAGACTGGCAGTGTGGAAATGG + Intronic
1097184292 12:57188418-57188440 GGTGACTGACATTGGGGGACTGG - Intronic
1097992728 12:65853113-65853135 GGGAACTGGGAGTGTGGCACTGG + Intronic
1098458736 12:70707694-70707716 GGGCACTCGCAGTGTGGAAGAGG + Intronic
1101082855 12:101207132-101207154 GGTGCCAGGCAGTTGGGAACGGG - Intronic
1101475274 12:105040399-105040421 GGTGAGTGGCAGTGGGGAGGGGG - Intronic
1101981994 12:109415620-109415642 GGTGAGTGGCCGTGGGGTACAGG + Exonic
1102097168 12:110249887-110249909 GGTGCCTGGCGGGGTGGAACAGG - Intergenic
1102705288 12:114875436-114875458 GTTGACTGGCTGTGTGGAGGGGG + Intergenic
1103527498 12:121578327-121578349 GGGGCCTGCCAGTGAGGAACTGG - Intronic
1112463844 13:99625973-99625995 GGTGGCTGGCTGCGTGGAAGAGG + Intronic
1115160617 14:30389769-30389791 GGTGACAGGCTGTGTGGAACAGG + Intergenic
1117834251 14:59785797-59785819 GGTGAATGGAAGGGTGGAAAGGG - Intronic
1118028048 14:61790774-61790796 GGTCACTGGAGGTGTGGATCTGG + Intronic
1120038047 14:79720414-79720436 GGAGCCTGGCAGAGTGAAACAGG - Intronic
1120607669 14:86599377-86599399 GGTGCCTGCCAGTGATGAACTGG + Intergenic
1121588217 14:95078636-95078658 GGTGCCGGGCAGTGTGGCAGCGG - Intergenic
1122514436 14:102297330-102297352 GGAGTCTTGCAGTGTGGACCAGG - Intronic
1122582384 14:102778329-102778351 GCTGGCTGGCGGCGTGGAACCGG - Intronic
1127094189 15:55496435-55496457 AGTGACTGGCAGCCTGGAACTGG - Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1130486790 15:84402610-84402632 GGTGAGTGGAGGTGTGGACCAGG - Intergenic
1131281170 15:91022492-91022514 GCTGACGGGCAGAGTGGATCAGG - Exonic
1131669095 15:94600381-94600403 GGTGACTGGGAGTGGGGAGAGGG - Intergenic
1132426867 15:101724690-101724712 GGTCACGGGCAGTGGGGAAATGG + Intergenic
1134212571 16:12289970-12289992 CGTCACTGGCAGTGTGGAGCTGG + Intronic
1136033041 16:27517323-27517345 GCTGACTTGTAGTCTGGAACAGG - Intronic
1137644668 16:50063596-50063618 GGGGACAGGCAGGGTGGAAATGG + Intergenic
1140314822 16:73885817-73885839 AGTGACTTGCAGTGTTTAACAGG - Intergenic
1141842334 16:86581056-86581078 GGTGACTGGCAGTCTGGGGAGGG + Exonic
1142033652 16:87850820-87850842 GCGGAATGGCAGTGTGGAAAGGG + Intronic
1144187914 17:12813866-12813888 GGTGAGTACCAGTGTGGAACTGG + Intronic
1144835484 17:18154585-18154607 GGTGAGTGGCAATGTGGGAGGGG - Intronic
1144853894 17:18257818-18257840 GGTGACTGGCAGGGTCGGCCTGG - Intronic
1147783534 17:42961288-42961310 AGTGACTCGCCGTGGGGAACAGG - Exonic
1148860851 17:50603678-50603700 GGTGACTGGCTGATTGGAAAGGG - Intronic
1152388711 17:79990523-79990545 GGTGACTGGGACTGTGAGACTGG - Intronic
1152482042 17:80560739-80560761 GGGGAGTGGCAGTGTGGGAAGGG - Intronic
1152829593 17:82489119-82489141 GGTGACTGGCTGTGAGGAATGGG - Exonic
1152829601 17:82489150-82489172 GGTGACTGGCTGTGAGGAATGGG - Exonic
1152829623 17:82489231-82489253 GGTGACTGGCTGTGAGGAATGGG - Exonic
1154214044 18:12402271-12402293 GGTGACACGGAGTGAGGAACAGG + Intergenic
1156440329 18:37179920-37179942 GGTTACTGGCAGTGTGATATGGG - Intronic
1158202169 18:54953179-54953201 TGGGACTGGCAGTGGGGGACAGG + Intronic
1158240242 18:55369466-55369488 GGAAACTGGCATTGTGGCACAGG - Intronic
1160107668 18:75993618-75993640 GGTGACAGGCAGTGGGGAGCTGG - Intergenic
1160205280 18:76826455-76826477 AGTGAGTGGCAGTTGGGAACTGG + Intronic
1163471637 19:17500654-17500676 GGTGACTGGCTGTGCGGATGGGG + Intronic
1167260267 19:48454263-48454285 GGAGACTGGCAGTGGGGGACGGG - Exonic
925819481 2:7785918-7785940 AGTGGCTGGCATTGTGCAACTGG - Intergenic
928161975 2:28936062-28936084 TGTGACTGGCAGTATGGAATTGG + Intronic
929558742 2:42942419-42942441 GGGGACTGGCAGTGTGCACATGG - Intergenic
932560315 2:72862299-72862321 GGTGGCTGGGAGAGTGGAAGTGG - Intergenic
933585781 2:84178128-84178150 GGGAACTGGCAGAGTGGAAAGGG - Intergenic
937076042 2:119107638-119107660 GGGCACTGGCAGTCTGAAACAGG + Intergenic
938955030 2:136289323-136289345 GATGGCTGTCAGTGTGGAAGTGG - Intergenic
938986817 2:136584548-136584570 GGTGATAGGCAGTTTGGAGCTGG + Intergenic
939881055 2:147631887-147631909 GGTGACTGGTAATTTGGCACAGG - Intergenic
942114581 2:172715275-172715297 GGTGACTGGGAATGAGGAACTGG + Intergenic
942572567 2:177328795-177328817 GGTGACTGGAAGTGTTGTATTGG - Intronic
944450642 2:199838714-199838736 GGTGCCTGTCTGTGTGGATCAGG - Intronic
945078462 2:206064372-206064394 GATGGCTGGAAGTGTGGAAGAGG - Intronic
946410600 2:219513452-219513474 GGTGCCTGGCAGAGTGGGGCAGG - Intergenic
1169554210 20:6732204-6732226 GGTGCCTGGCAGGGGGGAAAGGG + Intergenic
1170745161 20:19092488-19092510 GAAGACTGGCTGTGTGGATCTGG + Intergenic
1172128450 20:32639414-32639436 AGTGATTTGCAGGGTGGAACTGG - Intergenic
1172747840 20:37226789-37226811 GATGACAGGCAGTGTGGGAGTGG - Intronic
1173208043 20:41009926-41009948 GGTCACTGACAGAGTGAAACAGG + Intergenic
1173837937 20:46138105-46138127 GCTGAGTGGCACTGGGGAACAGG - Intergenic
1174305382 20:49611095-49611117 GTTGCCTGGCAGTGTGGACGTGG + Intergenic
1175898781 20:62351857-62351879 GGGGACTGGCCGGGTGGACCCGG - Intronic
1178675301 21:34626318-34626340 GGCGACTGGCTGTGTGGAGTGGG - Intergenic
1179085596 21:38214891-38214913 GGTGACTGTCAGTCTGGATCAGG - Intronic
1179193666 21:39144635-39144657 GGAGGCTGGCATTCTGGAACAGG + Intergenic
1179710891 21:43212385-43212407 GGTGGCTGGCAGAGAGGCACTGG + Intergenic
1179792023 21:43761343-43761365 GGTGAGTGGCCCTGTGGCACTGG - Exonic
1179824648 21:43957310-43957332 GGCAGCTGGCGGTGTGGAACAGG + Intronic
1180000519 21:44993445-44993467 GGTGCCTGGCAGCGCTGAACGGG - Intergenic
1180070702 21:45434728-45434750 GCTGACTGGCAGTGGGGAGATGG + Intronic
1180737095 22:18025173-18025195 GCTGGCTGGAAGTGTGGAAGAGG - Intergenic
1180737099 22:18025195-18025217 GCTGGCTGGAAGTGTGGAAGGGG - Intergenic
1181099595 22:20530560-20530582 GGGGCCTGGCAGTGTGGCAGGGG + Intronic
1181388020 22:22558694-22558716 GCTGACTGGGAGTGTGGGACGGG + Intronic
1181497120 22:23293643-23293665 GGTGCCAGGCAGTGTGCAAAAGG + Intronic
1182459063 22:30471580-30471602 GGTGCCTGGGAGGGAGGAACGGG + Intronic
1182912782 22:34001206-34001228 ACAGACTGGCAGTGTGGAAGAGG + Intergenic
1184557511 22:45241074-45241096 GGAGACTGGCCGTTTGGAAGTGG - Intergenic
1184684037 22:46088004-46088026 GGTGCCTGGCAGTGGGGCCCTGG - Intronic
1184785450 22:46669391-46669413 GGTGGCTGGCGGTGAGGACCGGG + Intronic
1185339024 22:50283452-50283474 GGCGACAGGCAGTGTGGCCCAGG + Intronic
949415645 3:3811047-3811069 GGTGACCAGCTGTGTGGTACTGG - Intronic
952763166 3:36933568-36933590 GGTGACAGGTAGTGTGGACCAGG - Intronic
953589943 3:44241930-44241952 GGTGACTGGCGGTGTGGGGTGGG + Exonic
953888052 3:46729346-46729368 GTAGACTTGCAGTGTGGAACGGG + Intronic
957631688 3:82723764-82723786 GGTCACAGGCAGAGTTGAACTGG + Intergenic
959106416 3:102069940-102069962 GGGGACTGGGATTGTGGAACTGG + Intergenic
960084134 3:113572549-113572571 CATGAGTGGCAGTGTGGAAGAGG + Intronic
961001775 3:123378979-123379001 GGTGCCTGGCCCTGTGGAAAAGG + Intronic
961661872 3:128473321-128473343 GGAGCCTGGCAGTGTGGACTGGG + Intergenic
961669467 3:128518425-128518447 TGAGACAGGCAGTGTGGAAGAGG + Intergenic
961944271 3:130670203-130670225 GGTGTCTGGCAGCTTGGAAAAGG + Intronic
962324702 3:134423383-134423405 GGTGACTTGCATTGTGGACTGGG - Intergenic
962862709 3:139419294-139419316 GGTGAGTGGTAGTGCTGAACTGG - Intergenic
969601803 4:8181297-8181319 TGTGACTGGCTGTGTGACACAGG - Intergenic
969644536 4:8419818-8419840 GGTGACTGGCAGTGTGGAACTGG - Intronic
972359386 4:38313602-38313624 TCTCCCTGGCAGTGTGGAACTGG + Intergenic
974650475 4:64748311-64748333 TGAGAATGGCAGTGTGGAAGGGG + Intergenic
974877009 4:67713564-67713586 AGTGACTGGCAATCAGGAACTGG - Intergenic
975845090 4:78516487-78516509 GGGGGCTGGCAGTTTGGAACAGG - Intronic
980665068 4:135922905-135922927 AGTGATTAACAGTGTGGAACTGG - Intergenic
983675309 4:170285661-170285683 GATGACTGTTAGTGTGGAAATGG + Intergenic
985765995 5:1779894-1779916 GCTGACAGGCAGTGGGGACCAGG - Intergenic
985985887 5:3515891-3515913 GGGGACTGGCAAGGTGGAAGGGG + Intergenic
987058026 5:14213879-14213901 GGAGACTGACAGTGAGGGACGGG + Intronic
987333689 5:16879586-16879608 GGTCACTAGCTGTGTGGCACTGG - Intronic
988469932 5:31528269-31528291 GGTAATTGGCAGTGTGGGTCTGG - Intronic
989489486 5:42033276-42033298 GGTGACTCCTAGTGTTGAACTGG - Intergenic
992717049 5:79521272-79521294 AGTGATTGACAGTTTGGAACTGG + Intergenic
992754457 5:79891059-79891081 GGAGGCTGGCAATGTGGAAGAGG - Intergenic
996588416 5:125117894-125117916 CGTGACTGGGAATGGGGAACAGG + Intergenic
1002082510 5:176745894-176745916 GGGGACTGGGTGTGTGGAAGGGG + Intergenic
1003516559 6:6823392-6823414 GGAGTCTTGCTGTGTGGAACAGG - Intergenic
1005007956 6:21309134-21309156 GGGGAAAGGCAGTGTGGAAAGGG - Intergenic
1005452554 6:25987835-25987857 GGTGACAGGAAGTGTTGAAAAGG - Intergenic
1005851402 6:29825633-29825655 AGTGACAGCCAGTGAGGAACAGG + Intergenic
1006273634 6:32983576-32983598 GGTTACAGGCAGGCTGGAACTGG - Intergenic
1006380786 6:33695889-33695911 GGTGTCTGGCAGAGTGGGAGTGG - Exonic
1006893173 6:37447398-37447420 GCAGACTGGCAATGCGGAACAGG + Intronic
1007904652 6:45447188-45447210 AGTGAGTGGCAGTGTGCAGCAGG + Intronic
1010474184 6:76265554-76265576 GGTGTATGGGAGTGTGGAAAGGG + Intergenic
1011212757 6:84971894-84971916 ACTTACTGGCAGTGTGGCACTGG + Intergenic
1017661803 6:156682202-156682224 GGTGACTGCCATTTTGGAAAAGG - Intergenic
1019300228 7:299367-299389 GGTGACTGGGAGGGTGCAGCGGG - Intergenic
1023180947 7:37483037-37483059 GGTGGGTGGGAGTGTGGAGCAGG - Intergenic
1023577548 7:41645365-41645387 GATGAATGGCAGTGTGGATGGGG - Intergenic
1023939462 7:44760450-44760472 GTTCCCTGGCAGTGGGGAACTGG - Exonic
1024632390 7:51260748-51260770 GGGGACTGACAGTGTGCAGCAGG + Intronic
1024663117 7:51518710-51518732 TGTGACTGCCAATGTGGGACTGG - Intergenic
1026388094 7:69871866-69871888 GGTGACTGAAATTGTGAAACTGG + Intronic
1027345213 7:77252666-77252688 TGTAACTGGCACTGTGGAAACGG + Intronic
1028940680 7:96519172-96519194 AGTGACTGGCAGAGAGGAATGGG + Intronic
1034826365 7:154268397-154268419 GATGACTGTCAATGAGGAACGGG - Intronic
1036949747 8:13129868-13129890 GGTGAATGGTAGGGTGGATCAGG + Intronic
1036956180 8:13190753-13190775 GGTGAGTGGAAGGGTGGCACAGG + Intronic
1037535210 8:19817383-19817405 GGAGGCTGGCAGAGTGGATCGGG - Exonic
1040601081 8:48884353-48884375 GTTGACTGGGGGAGTGGAACGGG + Intergenic
1044598713 8:93982546-93982568 GGGGACTGGGAGTGGGGGACTGG + Intergenic
1046012948 8:108572586-108572608 GGCGACTGGCAGTGAGATACAGG - Intergenic
1047511544 8:125519811-125519833 GCTGCCTGGCAGTGTGGGGCAGG - Intergenic
1047563735 8:126017681-126017703 GCTTCCTGGCTGTGTGGAACTGG + Intergenic
1048463569 8:134642956-134642978 GGTGCCTGGCATTGTGGAACAGG - Intronic
1048686382 8:136909423-136909445 GGTGAGTGGCTGTGTTCAACGGG + Intergenic
1049459882 8:142721539-142721561 GGTGACTGGCAGGGCTGAATAGG - Intergenic
1049645973 8:143735771-143735793 GGGCAGTGGCAGTGGGGAACAGG - Intergenic
1052140791 9:24980089-24980111 GGTGGATGGCAGTATGGAATAGG + Intergenic
1058919862 9:109603313-109603335 GGAGACTAGCAGTGGGGAAGGGG + Intergenic
1059188221 9:112296944-112296966 GGTAACTGGCACTGTGGCAGTGG - Intronic
1060984996 9:127814829-127814851 GGTGAATGGCAGAGGGGAACTGG + Intergenic
1194990578 X:100543081-100543103 GGTGAGTCTCAGTGTTGAACTGG + Intergenic
1198298386 X:135309364-135309386 GGTGTGTGGCAGTGGGGAAGAGG + Intronic
1199454548 X:148013719-148013741 AGTGACTGGAAATATGGAACAGG - Intronic
1200218017 X:154377166-154377188 AGTGCCTGGCAGTGTGCAGCAGG - Intergenic
1200989293 Y:9334695-9334717 GGTGTGTGGGAGGGTGGAACTGG - Intergenic
1202369318 Y:24186470-24186492 GGTGAGTGGGGGTGTGGACCAGG - Intergenic
1202501467 Y:25483647-25483669 GGTGAGTGGGGGTGTGGACCAGG + Intergenic