ID: 969645654

View in Genome Browser
Species Human (GRCh38)
Location 4:8427399-8427421
Sequence CAGCCATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 4, 2: 50, 3: 140, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969645654_969645662 26 Left 969645654 4:8427399-8427421 CCATCCACCACTGCTGATGGCTG 0: 1
1: 4
2: 50
3: 140
4: 350
Right 969645662 4:8427448-8427470 ACCCCCCTCCAGATCCAGCAGGG 0: 1
1: 1
2: 18
3: 81
4: 306
969645654_969645661 25 Left 969645654 4:8427399-8427421 CCATCCACCACTGCTGATGGCTG 0: 1
1: 4
2: 50
3: 140
4: 350
Right 969645661 4:8427447-8427469 CACCCCCCTCCAGATCCAGCAGG 0: 1
1: 0
2: 4
3: 39
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969645654 Original CRISPR CAGCCATCAGCAGTGGTGGA TGG (reversed) Intronic
900435317 1:2628344-2628366 CAGCCTCCCGCAGGGGTGGAGGG + Intronic
900482332 1:2905282-2905304 CACAGATCAGCAGTGTTGGAGGG + Intergenic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
906703457 1:47876687-47876709 CAGCCTCCAGCAGTGCTGGGAGG + Intronic
906779417 1:48559174-48559196 CAGCCATCAGCAGTTCTGCTTGG - Intronic
907396688 1:54195607-54195629 CAGCCATCATCAGTGGGGCTTGG + Exonic
907411830 1:54288570-54288592 CATACATCAGCAGGGGTGGGGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
908930885 1:69315132-69315154 CAGATGCCAGCAGTGGTGGATGG + Intergenic
910114763 1:83719596-83719618 CAGGGATTAGCAGTGATGGAGGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911483804 1:98479841-98479863 CTGCCATAAGCAGTGATGCATGG + Intergenic
912723909 1:112042537-112042559 AAGCCATCAGAAGTGGGTGAGGG - Intergenic
913119978 1:115731011-115731033 CATCCATCAGTTGGGGTGGAGGG - Intronic
915462594 1:156079124-156079146 CAGCCATCTGGAGTGGAGGAAGG - Intronic
915532164 1:156508952-156508974 CAAACATCAGCAGTGGAGGGAGG + Intergenic
915988821 1:160492560-160492582 CAGCCATCAACACTGGATGAGGG - Intronic
916954763 1:169820426-169820448 CAGCCGTCAGCAGGAGTGCAAGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917367118 1:174244419-174244441 CAGGCATCAACAATGGTAGAAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921157430 1:212449485-212449507 CAGCCATCTGCAAGGGGGGAAGG - Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922788767 1:228298031-228298053 CATGCATGAGCAGTGCTGGATGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923010665 1:230085160-230085182 CTGCCATCCGCAGTGGTGAAAGG - Intronic
924176387 1:241395761-241395783 CAGACATCATCCGTGGTGGCTGG - Intergenic
1064095171 10:12418857-12418879 CATCCCTCGGCAGGGGTGGACGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065444796 10:25787232-25787254 CAGGCAGCAGAAGTGGTGAAAGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067790990 10:49287701-49287723 CAGCCACAAGCAGTGTTGGGAGG + Intergenic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070628134 10:78065843-78065865 CAGCCACCTGCAGAGGGGGAGGG + Intergenic
1071016398 10:81002110-81002132 CAGACATATGAAGTGGTGGAAGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072881776 10:99235528-99235550 CAGCCATCATGAATGATGGACGG + Exonic
1073516234 10:104077920-104077942 CAGCCACTAGAAGTGCTGGAGGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075733302 10:124649028-124649050 CAGGCAACAGCAGCAGTGGAAGG + Intronic
1075973270 10:126673036-126673058 CAGCCACCAGCTGTGGTCAAGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077305940 11:1868724-1868746 GAGCCAGCAGCAGGGGTGCAGGG + Intronic
1077368284 11:2170079-2170101 CAGTCAGAAGCAGTGGTGGTGGG + Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080419444 11:32096923-32096945 CTGCCATCAGCACTGGTTGGGGG + Intronic
1080464146 11:32481278-32481300 CAGCCACAACCAGTGGGGGATGG - Intergenic
1080749791 11:35141217-35141239 TAGCCAGGAGCAGTGCTGGATGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081063030 11:38503995-38504017 CCACAATCAGCAGTGGGGGATGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083414644 11:62517659-62517681 CAGACATCAGCCTTGGTGAAGGG - Exonic
1083505122 11:63149552-63149574 CAGACATCAGCAATGGAGGAAGG + Intronic
1083920654 11:65780195-65780217 CCGCCAGCAGCAGTGGCCGACGG + Exonic
1084301636 11:68256260-68256282 AAGCCATCAGCCATGCTGGATGG + Intergenic
1084653200 11:70500913-70500935 CAGACATGAGCAGAGGTGGCGGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1086058305 11:82674398-82674420 CAGGCAACAGAAGTGATGGATGG + Intergenic
1086883858 11:92180776-92180798 CAGTCATCAGCTGTGGCGGTGGG + Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089985656 11:122810431-122810453 CAGCCAGCAACACTGGTGTATGG - Exonic
1092972793 12:13714152-13714174 AATCCATCAGGAGTGGTGGGTGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094486617 12:30930437-30930459 CAGCCAGCAGCAAGGGTGGCCGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095291682 12:40485743-40485765 CAGCTATCAGCTGTGGTGACAGG + Exonic
1095291829 12:40486760-40486782 CGGCCATCAGCTGTGGTGACAGG + Exonic
1095291948 12:40487540-40487562 CGGCCATCAGCTGTGGTGACAGG + Exonic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095680806 12:44973181-44973203 TAGACATCAGCAGGGGTGGTGGG - Intergenic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099285118 12:80707786-80707808 CAGCCATTAGAAGTGGCAGAAGG + Exonic
1100085264 12:90902668-90902690 CACCCATGAGCAATGGTGAATGG - Intergenic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104577759 12:129983460-129983482 CAGCCATCAGCTGAGGGTGAAGG + Intergenic
1104763548 12:131312547-131312569 GAGCCATCAGCAGGGATGGGAGG - Intergenic
1104815954 12:131645530-131645552 GAGCCATCAGCAGGGATGGGAGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107719263 13:43230714-43230736 CAGCCCTGAGCGGTGGGGGAGGG - Intronic
1108672876 13:52709650-52709672 CAGCCATCAGCCCTGCTGCAGGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111690368 13:91556077-91556099 CAGGGGTCAGAAGTGGTGGAAGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112549806 13:100409078-100409100 CAAGCCTCAGCAGTGGAGGAGGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113641235 13:111958726-111958748 CAGCCAGCACCACTGGTTGAGGG - Intergenic
1113707366 13:112443528-112443550 CAGCCCCCAGAAGTGGCGGAGGG - Intergenic
1113965330 13:114149908-114149930 ATGCCATCAGCAGTGGTGAAGGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116012379 14:39366581-39366603 CAGATGCCAGCAGTGGTGGATGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116375720 14:44197793-44197815 CAGCCTTCAGAAGTGTTGGTTGG - Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1116870362 14:50064132-50064154 CAGCTACCAGGAGTGCTGGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118471913 14:66082199-66082221 AAGCCACCAGCAGTCCTGGAGGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119960944 14:78856083-78856105 CAGTCATAAGCAGTGGATGAGGG - Intronic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1122249767 14:100429700-100429722 CAGCCAGCAGCATTGGTGTCAGG + Intronic
1122420576 14:101574017-101574039 CAGCCATCAGCGGGAATGGAGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123795168 15:23763662-23763684 CAGCCTGGAGCAGTGGTGGGAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125254219 15:37744829-37744851 CAGCTATGAGCAGTGGTGATGGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1129254344 15:74325598-74325620 CAGTCATCAGCAGTTGCTGAAGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129882574 15:79016929-79016951 CAGCCAACAGCAGAAGGGGAGGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132930956 16:2459094-2459116 CCTCCATCAGCGGTGGGGGAGGG - Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1133830124 16:9315255-9315277 CAGCCATCAGCAAGAATGGAAGG - Intergenic
1135638830 16:24102229-24102251 CAGCTATCCTAAGTGGTGGATGG - Intronic
1136551691 16:30985481-30985503 CAGCCATCAGCAGGGGCAGACGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137483044 16:48868318-48868340 CAGCCTTCAGAGGTGGTGAAAGG - Intergenic
1137555416 16:49467369-49467391 TAGCCATCTGCAGGGGAGGAAGG + Intergenic
1138206108 16:55126411-55126433 CAGACATAAGCAGGGGAGGAGGG - Intergenic
1139965794 16:70744662-70744684 CAGCCACCTGCAGGGGTGGGAGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141617089 16:85216029-85216051 CAGCCAACAGGAGTTGGGGAGGG + Intergenic
1141739858 16:85883969-85883991 CAGCCATCATTAGAGGAGGAAGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142311870 16:89318865-89318887 CAGGCATCAGGGATGGTGGATGG - Intronic
1142940517 17:3376798-3376820 CAGCCAGCAGAATTGGGGGAGGG - Intergenic
1143047915 17:4097356-4097378 CAGCCATCAGCCATGGTTGTAGG - Intronic
1143166003 17:4897609-4897631 CAGTCAGCAGCAGTGGGGTAAGG - Exonic
1143950467 17:10628731-10628753 CAGCCGGCAGAAGTGGTGGGTGG - Intronic
1145238780 17:21227345-21227367 CAGCCACCAGAAGTGGGAGAGGG - Intergenic
1147898237 17:43766573-43766595 CATCCATCACCATGGGTGGAAGG + Exonic
1148207739 17:45790138-45790160 CAGCCATCAGCTGAGCTTGAAGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149667027 17:58372089-58372111 CAGACATCAACAGTAGTAGAGGG - Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151692996 17:75698530-75698552 CAGACATATGCAGTGGTGGCTGG + Intronic
1151693000 17:75698563-75698585 CAGACATATGCAGTGGTGGCTGG + Intronic
1151693004 17:75698596-75698618 CAGACATATGCAGTGGTGGCTGG + Intronic
1151693008 17:75698629-75698651 CAGACATATGCAGTGGTGGCTGG + Intronic
1151693012 17:75698662-75698684 CAGACATATGCAGTGGTGGCTGG + Intronic
1153056267 18:949613-949635 CAGATGCCAGCAGTGGTGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156339349 18:36197194-36197216 AAGGCATCAGCAGTGGTGGTGGG + Intronic
1156916455 18:42468308-42468330 CAGCCATCAGCAGTTGTAATGGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159895585 18:73992618-73992640 CAGCCAGCAGCAGTTGGGGTTGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG + Intergenic
1162248157 19:9420086-9420108 CAGCCATCAGCCCTGTGGGATGG - Exonic
1163730611 19:18947179-18947201 CCGCCATCAGCAGCGCTTGAAGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164484047 19:28639572-28639594 CAGACATCTGCTGGGGTGGAGGG + Intergenic
1166627753 19:44374776-44374798 CAGATATCAGGAATGGTGGAAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925038374 2:709636-709658 CTGCCAGAAGCAGTGGTGCACGG + Intergenic
926208994 2:10854894-10854916 CAGCTATCAGAAGTGGTGCCTGG - Exonic
926599797 2:14830188-14830210 CAGCAATGAGCAGAGGTAGAGGG + Intergenic
927523959 2:23720721-23720743 CAGGCATCAGCAGTGGCAGTGGG - Intergenic
927674067 2:25091560-25091582 CAGCCATGGGCAGTGGTGAGAGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928405084 2:31008656-31008678 CAGCCAGCATGAGTGGTGGGAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928526396 2:32145795-32145817 CAGCCAGCATCGGTAGTGGATGG + Intronic
928674557 2:33637542-33637564 CAGCCAAATGCAGTGGTGGCAGG + Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931471321 2:62540440-62540462 CAGCTCTAAGCAGAGGTGGAAGG - Intergenic
931644579 2:64410271-64410293 AAGTCATCTGCAGTTGTGGATGG - Intergenic
932305915 2:70704279-70704301 CTGCCAGGAGCAGAGGTGGAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937826481 2:126372964-126372986 CTTCCAGCAGCGGTGGTGGATGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943290073 2:186059334-186059356 TTGCCATCAGCCGGGGTGGAAGG - Intergenic
943318540 2:186417554-186417576 CAGCCATAACCTGTGGAGGAAGG + Intergenic
944496786 2:200315342-200315364 CAGCCATCATCAGAAGTGGGAGG + Intronic
947966354 2:234284883-234284905 CAAACAGCAGCAGTGATGGAAGG - Intergenic
947984728 2:234438410-234438432 CAGCCTTCAGCAGAGGAGGCAGG - Intergenic
948174276 2:235930909-235930931 CGGCCATCAGCAGTGGTAAGAGG + Exonic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172963176 20:38813114-38813136 CAGCCATCTGCTGTGCTGGCTGG + Intronic
1173290941 20:41714776-41714798 CATCCATCAGCAGTGGGAGATGG - Intergenic
1173443579 20:43098111-43098133 CAGCCATCCCCAGAGATGGAAGG + Intronic
1174295803 20:49544228-49544250 CAGCCATGAGCAGTGGCCAAGGG - Intronic
1174352102 20:49975822-49975844 TAGCTGTCAGCAGGGGTGGAAGG - Intergenic
1174595245 20:51678615-51678637 CAGCCATCTGCTGTGGTGACAGG - Intronic
1176687742 21:9866146-9866168 GATCCATCTGCAGTGGTGGTTGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179840570 21:44070278-44070300 CAGCAATCAGGAGAGGAGGAGGG + Intronic
1179988861 21:44935438-44935460 CAGCCATGGCCAGTGGTGAAAGG - Intronic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1182247674 22:28972718-28972740 TTGCCATCAGCAGTGTTTGAGGG + Intronic
1184361300 22:44020475-44020497 CTGGCATCAGAAGTGGTGGCAGG - Intronic
949340216 3:3021597-3021619 CAGCCATCTTCATTTGTGGAAGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953182746 3:40611993-40612015 CAGGCATCAGCAAGTGTGGAGGG - Intergenic
953369159 3:42372657-42372679 CAGCCATGACCACTGGTGGGTGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954400446 3:50316913-50316935 CAGCCAGCAGCAGGGGAGCAGGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
959515651 3:107263862-107263884 CAGGCCTCAGCTGTGGTGGGAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961643150 3:128377823-128377845 CTTCCATCAGCAGTGGGTGAAGG + Intronic
961728590 3:128950367-128950389 CAGCCATGAGCAGTGGGCCAGGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964662901 3:159140380-159140402 CAGAGATGAGCAGTTGTGGATGG + Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968108029 3:196016618-196016640 CTGCCAGGAGCTGTGGTGGAGGG - Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968520679 4:1033450-1033472 CAGGCAGCAGCAGCTGTGGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969313555 4:6368271-6368293 CAGCCAGCAGCAGGCGTGGCTGG + Intronic
969449467 4:7264822-7264844 CAGCCAGCAGCAGGGCTGCACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
971824498 4:31603945-31603967 CAGCCTTCAGCCGTGGCTGAAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976454520 4:85230155-85230177 CAGCCATGAGCAGTGCTGGTTGG + Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977630688 4:99239301-99239323 CAAGCCTCAGCAATGGTGGATGG + Intergenic
977654549 4:99505690-99505712 CAGTCTCCAGCAGGGGTGGAGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980351096 4:131683960-131683982 GATCCATCTGCAGTGGTGGTTGG + Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982771472 4:159400943-159400965 CAGCCAGCAGCAGTTCTGCAGGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
987572932 5:19688000-19688022 CAGGTGCCAGCAGTGGTGGATGG - Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988330172 5:29827446-29827468 CTGCCATCAGCAGGGGGTGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990467121 5:56080837-56080859 CAGCCATCAGCTGTGGTCCCAGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995229269 5:109740229-109740251 CAGGGATCAGCAGTTGGGGAAGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997283349 5:132662142-132662164 CAGCCATGAGCAGTCGAGGGCGG - Intergenic
999108269 5:149093194-149093216 CAGCCATAAGCAGCTGTTGAGGG - Intergenic
1000123971 5:158225638-158225660 CAGCCATTAGCTGAGGTTGAAGG - Intergenic
1000536562 5:162485597-162485619 CAGCCAGCAGCACTAATGGAGGG + Intergenic
1001397730 5:171428956-171428978 GAGCCATCAGCAGGGGAGGGGGG - Intronic
1001439964 5:171735190-171735212 GAGCCAGCAGCCTTGGTGGATGG + Intergenic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004047137 6:12037113-12037135 CAGTCAGGAGCAGTGATGGAGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1006506036 6:34489419-34489441 CATCCAGCAGCAGTGCTGGGTGG + Intronic
1006511123 6:34521709-34521731 CAGGCAACGGCGGTGGTGGATGG + Intronic
1006538511 6:34720423-34720445 CAGCCACCAACAGTGGTTGTGGG - Intergenic
1006940505 6:37748908-37748930 CAGCCCTCATCAGTGATGGATGG + Intergenic
1007226825 6:40321037-40321059 CAGCCACCAGCAGGGGAGAAGGG + Intergenic
1007371472 6:41429078-41429100 CAGCCATCGGCACTGGTGCAGGG + Intergenic
1007917264 6:45573091-45573113 CAGCCAGAAGCAGAGGAGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010538701 6:77063827-77063849 CAGCCATCAGCAGATGTCAATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013392947 6:109704975-109704997 CATCTATCAGGAGTGGGGGAGGG + Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1013560307 6:111296914-111296936 CTGCCATCAGCTGTGGAGGTTGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017014434 6:150088820-150088842 CAGCCATCAGTGGTGGAGGGAGG + Intergenic
1018311672 6:162516143-162516165 CAGTCATCAGCTGTGAAGGAGGG - Intronic
1018353623 6:162989375-162989397 CATGCCTCAGTAGTGGTGGAAGG + Intronic
1019695934 7:2446170-2446192 GAGCCAGCAGCAGGGCTGGAAGG + Intergenic
1019904119 7:4047988-4048010 CAGCCATGACCAGCAGTGGATGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021517227 7:21502246-21502268 CAGACATCAGCCGTGGTGTATGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024268226 7:47622597-47622619 CAGACATCAGCACTGTTTGAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026440244 7:70437884-70437906 CAGTCTTCAGCAGTGGTAGAAGG + Intronic
1027434395 7:78149267-78149289 AAGGCATTAGCAGTGGTGGTAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029477306 7:100792586-100792608 GAGCGTTCAGCAGAGGTGGACGG - Intronic
1029708967 7:102289311-102289333 CAGCCATGTGGTGTGGTGGAGGG + Intronic
1030059565 7:105612030-105612052 CAGCCAGAAGCGGTGGTGAAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031331085 7:120465383-120465405 CAGCCCTCAGCAATGGTTGGAGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033501152 7:141950947-141950969 CAGCCTTCATCTGTGGTTGAAGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035242457 7:157541151-157541173 CAGCCACCCGCCTTGGTGGACGG + Intronic
1035267650 7:157700554-157700576 CCGCCATCAGCATAGGGGGATGG - Intronic
1036066886 8:5390597-5390619 GAGACATCAGCGGGGGTGGAGGG - Intergenic
1037044085 8:14275766-14275788 CAGCCACCAGCAGCAGTAGAAGG - Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1040955277 8:52973792-52973814 CTGCCATCACCAGTGTGGGATGG + Intergenic
1041172739 8:55161541-55161563 CAGACAGCAGCAGTAGTGGGAGG - Exonic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043489036 8:80729509-80729531 CAGGTTTCAGCTGTGGTGGAGGG - Intronic
1044292728 8:90491724-90491746 CAAGCCTCAGCAATGGTGGATGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047009720 8:120658712-120658734 CAGCCATCAGCATTGAGGCAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047995280 8:130329162-130329184 GAGGCAGCAGCAGTGGTTGAGGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049448121 8:142641035-142641057 CAGCCATCTGCAGGGCAGGAAGG - Intergenic
1049749242 8:144275675-144275697 CAGCCACCACCAGGGGTGGGGGG + Intronic
1050899907 9:10934127-10934149 CAGCCACCAGCAGGAGTGGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052993507 9:34536799-34536821 CAGTCCTCCGCAGTGGGGGAAGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053781614 9:41615753-41615775 GATCCATCTGCAGTGGTGGTTGG - Intergenic
1054169562 9:61825907-61825929 GATCCATCTGCAGTGGTGGTTGG - Intergenic
1054667976 9:67754908-67754930 GATCCATCTGCAGTGGTGGTTGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056540795 9:87569217-87569239 CAACCATCGTCAGTGGGGGAGGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057179559 9:93022406-93022428 CAGCGGTCAGCAGGGGTGAAAGG + Intronic
1057417288 9:94876290-94876312 CAGGCATCCTCAATGGTGGATGG - Intronic
1061620629 9:131809341-131809363 CAGGCACCAGCAGTGGTGCTGGG - Intergenic
1061684201 9:132261147-132261169 CTGCCAGAAGCACTGGTGGAGGG - Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186644628 X:11493497-11493519 AAGCCAGCAGGAGTGGTGGTAGG + Intronic
1188124338 X:26349916-26349938 CAGCCAGCAGCATTTTTGGAAGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188679707 X:32987373-32987395 CATCAATCAGAAGTGGTGTAGGG - Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190938876 X:55021013-55021035 CAGCCATCAGCAGTGGCCAGAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191591333 X:62888418-62888440 CAAGCATCAGTAATGGTGGATGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192724005 X:73728695-73728717 CAGCCACCAGGCTTGGTGGATGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193637884 X:83975460-83975482 CAGGCATCTTGAGTGGTGGATGG - Intergenic
1195146855 X:102026835-102026857 GAGCCAGCAGCAGTGGTGATGGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196008787 X:110864242-110864264 AGGCCATCAGCATTGTTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic
1198862288 X:141084202-141084224 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862295 X:141084226-141084248 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862308 X:141084274-141084296 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1198900382 X:141503098-141503120 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900395 X:141503146-141503168 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900402 X:141503170-141503192 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200136947 X:153879822-153879844 CAGCCAGCAGCAATATTGGAAGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic