ID: 969646960

View in Genome Browser
Species Human (GRCh38)
Location 4:8436262-8436284
Sequence GACTGGGAGCTATACATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 15, 2: 62, 3: 54, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969646958_969646960 -8 Left 969646958 4:8436247-8436269 CCTTGGGCATCAGTAGACTGGGA 0: 36
1: 30
2: 22
3: 65
4: 157
Right 969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG 0: 2
1: 15
2: 62
3: 54
4: 140
969646955_969646960 -4 Left 969646955 4:8436243-8436265 CCAGCCTTGGGCATCAGTAGACT 0: 29
1: 39
2: 23
3: 49
4: 201
Right 969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG 0: 2
1: 15
2: 62
3: 54
4: 140
969646953_969646960 5 Left 969646953 4:8436234-8436256 CCTCCGAGACCAGCCTTGGGCAT 0: 1
1: 12
2: 29
3: 55
4: 320
Right 969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG 0: 2
1: 15
2: 62
3: 54
4: 140
969646954_969646960 2 Left 969646954 4:8436237-8436259 CCGAGACCAGCCTTGGGCATCAG 0: 1
1: 22
2: 31
3: 56
4: 290
Right 969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG 0: 2
1: 15
2: 62
3: 54
4: 140
969646950_969646960 10 Left 969646950 4:8436229-8436251 CCTGACCTCCGAGACCAGCCTTG 0: 1
1: 14
2: 44
3: 124
4: 1689
Right 969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG 0: 2
1: 15
2: 62
3: 54
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969646960 Original CRISPR GACTGGGAGCTATACATGGA CGG Intronic
903644747 1:24888083-24888105 TAGGGGGAGCTAGACATGGAGGG - Intergenic
904170571 1:28589718-28589740 GACTGGGAGCTGTACGTGGATGG - Intronic
905061640 1:35144982-35145004 AACTGGGAGCTATACGTGGACGG - Intergenic
906499133 1:46328221-46328243 GACTGGGAGCTGTACGCGGATGG - Intergenic
906526226 1:46494759-46494781 GAGTTGGAGCTATGCATGGCAGG - Intergenic
909746189 1:79100071-79100093 GACTGGGATCTGTACTTAGAAGG + Intergenic
910852772 1:91665097-91665119 GACTGTGAGCAGTACGTGGATGG - Intergenic
911973389 1:104463978-104464000 GACTGGGAGCTATATGTGGACGG - Intergenic
912279312 1:108296792-108296814 GACTTGGAGTTCTACATGGCTGG + Intergenic
912288914 1:108397565-108397587 GACTTGGAGTTCTACATGGCTGG - Intronic
912570854 1:110619902-110619924 GACTGGGAGCTGTCCAGGGGAGG - Intronic
916766652 1:167867219-167867241 AACTGGGAGCTGTACGTGGATGG + Intronic
916929223 1:169557531-169557553 CATTGGGAGCTTTTCATGGAAGG + Intronic
917696589 1:177532077-177532099 TACTGGGAGATCTACAGGGAGGG + Intergenic
918647218 1:186918598-186918620 GACTGGGAGTTATACATGGACGG - Intronic
919267600 1:195291400-195291422 GAGTGGCAACTATACATGCAGGG - Intergenic
920450361 1:206056226-206056248 GACTGGGAGCTGTACATGGATGG + Intronic
921074824 1:211691919-211691941 GACTGTGAGCGGTACGTGGACGG + Intergenic
921746976 1:218750887-218750909 GACTGGGAGCTGGATGTGGACGG - Intergenic
921781598 1:219172083-219172105 CACTTGGAGATATACAGGGAAGG - Intergenic
921927337 1:220722291-220722313 GACTGGGAGCTGTATGTGGATGG + Intergenic
922680565 1:227592025-227592047 GACTGGGAGCTGTACGTGGATGG - Intronic
922690342 1:227684077-227684099 GACTGGGAGCTGTACGTGGATGG + Intergenic
922694005 1:227718014-227718036 GACTGGGAGCTGTACGTGGATGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924858883 1:247900970-247900992 GACTGTGAGCTGTATGTGGATGG - Intergenic
1063558096 10:7099820-7099842 GGCTGGGTGGGATACATGGATGG - Intergenic
1064397257 10:14991920-14991942 GACTGGGAACGATATGTGGATGG - Intergenic
1064400153 10:15014389-15014411 GACTGGGAACTATAGGTGGACGG - Intergenic
1064410806 10:15102102-15102124 GATTGGGAGCTCTACGTGGGTGG + Intronic
1065955851 10:30692978-30693000 GAGTGGAAGCTAGTCATGGAGGG + Intergenic
1065982317 10:30912107-30912129 GCCTGTGAGCTATAGCTGGAGGG - Intronic
1066390368 10:34973239-34973261 GACTGGGAACTACACGTGGACGG + Intergenic
1071282197 10:84112954-84112976 GACTGGGAGTTATACATGGATGG + Intergenic
1071288236 10:84168673-84168695 GACTGGGAGCTGTACGTGGATGG - Intergenic
1072335001 10:94389952-94389974 GACTGTGAGCGGTACATGGACGG + Intergenic
1072689000 10:97558125-97558147 GACTGGGAGCTGTACGTGGATGG - Intronic
1072716688 10:97757039-97757061 GACTGGTAGCTATGTATGGCTGG + Intronic
1073052690 10:100678868-100678890 GACTGTGTGCTATATATGCATGG + Intergenic
1073803223 10:107066744-107066766 GATTGAGAGCTATAAAAGGAGGG + Intronic
1074661349 10:115661511-115661533 GACTGGAACTTATACATTGAGGG - Intronic
1077589060 11:3477773-3477795 GACTAGGAACTATACGTGGCTGG - Intergenic
1081875465 11:46405326-46405348 GACTGCGAGCTCCTCATGGAAGG + Intronic
1084227744 11:67727897-67727919 GACTGGGAACTATACGTGGATGG - Intergenic
1084244754 11:67849396-67849418 GACTGGGAACTATACGTGGCTGG - Intergenic
1084261152 11:67979586-67979608 GACTGGGAACTATACGTGGATGG - Intergenic
1084807485 11:71588968-71588990 GACTGGGAACTATACATGGATGG + Intronic
1084811500 11:71614511-71614533 CACTGGGAACTATACGTGCATGG + Intergenic
1084827930 11:71745160-71745182 GACTAGGAACTATACGTGGCTGG + Intergenic
1084844575 11:71888977-71888999 GACTGGGAACTATACTTGGATGG + Intronic
1084847428 11:71911431-71911453 GACTGGGAACTATATGTGGATGG + Intronic
1085998931 11:81955307-81955329 GACTGGGAGCTGTACATGGAAGG + Intergenic
1087276081 11:96161779-96161801 AACTGGGAGATATATCTGGAAGG - Intronic
1087895003 11:103577151-103577173 GACTGGGAGCTGTACTTGGACGG + Intergenic
1089896129 11:121931976-121931998 GACTGTAAGCTATTCAGGGAAGG - Intergenic
1091661532 12:2387610-2387632 GACTAGGAGCTAACCCTGGATGG - Intronic
1091752165 12:3029791-3029813 GACTGGGAGCTCTTCGTGCAAGG + Intronic
1092070026 12:5624706-5624728 GACTGGGAGCTCCACACGGCGGG - Intronic
1092432413 12:8420142-8420164 GACTGGGAACTATACGCGGATGG - Intergenic
1093289262 12:17301364-17301386 GCCTGGGAGCTGTATGTGGACGG + Intergenic
1096509040 12:52117108-52117130 GACTGGGAACTACACGTGGACGG - Intergenic
1098248585 12:68545313-68545335 GGCTGTGAGCTGTACGTGGATGG + Intergenic
1098748618 12:74268812-74268834 GACTGGGAGTCATACGTAGACGG + Intergenic
1099035772 12:77585616-77585638 TACTGTGAACTATACATGCAAGG - Intergenic
1101549242 12:105746730-105746752 GATGGGGAGCTACACAGGGAAGG - Intergenic
1102586465 12:113926578-113926600 GACAGGGAGCTCCACATAGAAGG - Intronic
1107544195 13:41421708-41421730 GACTGGGAACTATCCGTGGATGG - Intergenic
1109802973 13:67401677-67401699 GACTGGGAGTTATATGTGGACGG + Intergenic
1110653532 13:77971057-77971079 GACTGAGAGTTATACGTGGATGG - Intergenic
1113767746 13:112891554-112891576 GTCTGGGCGCTGCACATGGAGGG - Intergenic
1114867699 14:26617699-26617721 AAGTGGGAGCTAAACATTGAAGG + Intergenic
1117038760 14:51751428-51751450 GACTGGGAACTATAGGTGGACGG + Intergenic
1122974799 14:105166663-105166685 GACTGGGAGCCACACACGGCAGG + Intronic
1123917691 15:25048974-25048996 GACAGGGAGGGAGACATGGAGGG - Intergenic
1124109334 15:26772533-26772555 GACTGGGGGCTATCCCAGGAGGG + Intronic
1127096334 15:55515340-55515362 GACTGGGAGTTATACGTGGATGG - Intergenic
1128666860 15:69544727-69544749 GAGTGGGAGCTATAGAGGCAGGG + Intergenic
1128807227 15:70540077-70540099 GCCTGGGAGCGAGACCTGGAAGG - Intergenic
1131257726 15:90872725-90872747 GACTGGGAGCGATAAATTCACGG + Intronic
1134242596 16:12517069-12517091 GCCTGAGAGCTATTCATAGACGG - Intronic
1135574268 16:23573259-23573281 GACTCGAAGCTAGAGATGGAGGG + Exonic
1137801287 16:51264295-51264317 GGCTGGGAACTACACAGGGAAGG - Intergenic
1140457402 16:75113258-75113280 TCTTGGGAGCTGTACATGGAAGG - Intronic
1141294379 16:82753221-82753243 GACTGGCAGAAGTACATGGATGG + Intronic
1143561763 17:7700727-7700749 GACAGGGACCTATACAGAGACGG - Exonic
1145000406 17:19300896-19300918 GACTGGGAGCTCCACAGGGCAGG - Intronic
1146182219 17:30705757-30705779 CAGTGGGCGCAATACATGGAAGG + Intergenic
1146255266 17:31388675-31388697 TACTGGGAAATATACATGGAAGG - Intergenic
1146764350 17:35505701-35505723 GACTGTGAGCGGTACATGAATGG + Intronic
1149561081 17:57608406-57608428 AAGTGGGAGCTGCACATGGAGGG + Intronic
1153830573 18:8918693-8918715 GACTGTGAGCAGTACGTGGATGG + Intergenic
1154013953 18:10600025-10600047 GACTAGGAGCTGTACGTGGATGG - Intergenic
1155079646 18:22395995-22396017 GTATGGAAGCTATAAATGGAAGG - Intergenic
1155792139 18:29986230-29986252 GGCTGGGAGGTATAGAGGGATGG + Intergenic
1155966123 18:32037122-32037144 GACTGGTAGCAATACAGGAACGG - Exonic
1157944061 18:51958998-51959020 TATTGGGAGCTATACACTGATGG + Intergenic
1158292211 18:55954916-55954938 GACTGGGAGTTATACGTGGATGG + Intergenic
1160963405 19:1734799-1734821 GACTGGGACCTAGATATGGGGGG + Intergenic
1162284235 19:9726368-9726390 GACTGGGATTTATACATGGATGG - Intergenic
1162976613 19:14210045-14210067 CAGTGGGCGCAATACATGGAAGG - Intergenic
1163916759 19:20246858-20246880 GACTTGGAGTTATATGTGGATGG + Intergenic
1163943236 19:20514076-20514098 GACTTGGAGTTATATTTGGACGG - Intergenic
1163966399 19:20751068-20751090 GACTGGGAACTATACGTGGATGG - Intronic
1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG + Intergenic
1164216767 19:23157490-23157512 GACTGGGAGCTGTACGTGGACGG - Intergenic
1164481020 19:28611016-28611038 GACTGGGAGCTGTACGTGGACGG + Intergenic
1165778962 19:38421061-38421083 GACTGTGAGCTATGGGTGGAGGG - Intronic
1166318672 19:42003239-42003261 CATTGGGAGCCATACCTGGAGGG - Intronic
1168293499 19:55368477-55368499 CACTGGGAGCTCTACAGGTAAGG - Exonic
925066218 2:930678-930700 GACTTGCAGCTATCCATGGAGGG + Intergenic
926441532 2:12893794-12893816 CATTTAGAGCTATACATGGATGG + Intergenic
926491260 2:13528607-13528629 GAATGTGAGCAGTACATGGATGG - Intergenic
932349911 2:71023355-71023377 GACTGGGAACTATACGTGGATGG + Intergenic
933889236 2:86751376-86751398 GCCTTTGAGCTATACATGCATGG - Intronic
935721301 2:105981733-105981755 GACTGGGAGCTGTACGTGGATGG - Intergenic
937412012 2:121684987-121685009 GACTGGGAGCTATACGTGGACGG - Intergenic
940869489 2:158848132-158848154 GACTTGGAACTATACGTGGATGG + Intronic
940872163 2:158869130-158869152 GACTTGGAACTATACGTGGATGG + Intergenic
940874376 2:158885131-158885153 GACTGGAAACTATACGTGGATGG + Intergenic
940947628 2:159636448-159636470 AACTGGCACCTATGCATGGAGGG + Intergenic
942151285 2:173077820-173077842 GACTTGGATCTAAAAATGGATGG + Intronic
943408292 2:187515479-187515501 GACTGGTAGCTGCACGTGGACGG + Intronic
944129449 2:196331194-196331216 GAATTGGATCTATAGATGGAAGG - Intronic
947594966 2:231405277-231405299 GACTGGGAACTATACATGGATGG + Intergenic
947785722 2:232817545-232817567 TACTAGGAGCTATGGATGGAGGG - Intronic
1171408515 20:24929994-24930016 GACTGGGAACTATACGTGGATGG + Intergenic
1175322547 20:58099637-58099659 CACTGGGAGCTTGACATGGTGGG - Intergenic
1177022952 21:15885856-15885878 CACTGAGAACTGTACATGGAAGG - Intergenic
1178447688 21:32660541-32660563 GACTGGGAGTTATACATGGACGG + Intronic
1179669249 21:42934125-42934147 GACTGGGAGCTGTACGTGGATGG + Intergenic
1179670701 21:42945416-42945438 GACTGTGAGCAGTACGTGGAGGG - Intergenic
1183899306 22:40993020-40993042 GAGAGGGAGGTAGACATGGAAGG + Intergenic
949158085 3:850904-850926 GACTGGGAGCTGTATATGAACGG + Intergenic
949884523 3:8682715-8682737 GACTGGGAACTATACGTGGATGG + Intronic
951048704 3:18070032-18070054 GACTAGGACATGTACATGGAAGG - Intronic
951166032 3:19486135-19486157 GACTGGGAGTTATATGTAGATGG - Intronic
957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG + Intergenic
957044425 3:75362964-75362986 GACTGGGAACTATACGTGGATGG - Intergenic
957076218 3:75605146-75605168 GACTGGGAACTATACGTGGATGG - Intergenic
957999719 3:87736213-87736235 GACTAGGAGCTGTATGTGGATGG - Intergenic
958143914 3:89599605-89599627 GATTGGAAGATATATATGGATGG - Intergenic
958621504 3:96569031-96569053 GTTTGGGAGCTATACATGACAGG - Intergenic
961272222 3:125697800-125697822 GACTGGGAACTATATGTGTATGG + Intergenic
961275081 3:125720033-125720055 GACTGGAAACTATACGTGTATGG + Intergenic
961277999 3:125742662-125742684 GACTGGGAACTATACGTGTATGG + Intergenic
961435332 3:126912750-126912772 GACTGGGAGGTAAATGTGGAAGG - Intronic
961876418 3:130026998-130027020 GACTGGGAACTATACGTGGATGG - Intergenic
961892869 3:130145155-130145177 GACTAGGAACTATACGTGGCTGG - Intergenic
962096561 3:132298725-132298747 GACTGGGAGCCGTATATGGATGG - Intergenic
962097560 3:132307755-132307777 GACTGTGAGCAGTACGTGGACGG + Intergenic
962387308 3:134942332-134942354 GACTGGGAGAGTTACTTGGAGGG + Intronic
963815822 3:149830036-149830058 GACTGACAGCTCTACATGGCTGG - Intronic
963816764 3:149839458-149839480 GACTGACAGCTCTACATGGCTGG + Intronic
966006659 3:175021951-175021973 GACTGGGAGTTACTCATGAATGG + Intronic
966240113 3:177746609-177746631 GAATAGGAGCTATGTATGGATGG + Intergenic
968988689 4:3894204-3894226 GACTGGGAACTATACGTGGATGG - Intergenic
969019667 4:4131446-4131468 GACTGGGAACTATACGTGGATGG - Intergenic
969024372 4:4161847-4161869 GACTGGGAACTATACGTGGATGG - Intergenic
969025277 4:4167793-4167815 GACTGGGAACTATACGTGGATGG - Intergenic
969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG + Intronic
969729446 4:8945318-8945340 GAGTGGGAACTATACGTGGACGG + Intergenic
969734184 4:8975959-8975981 GACCGGGAACTATACAAAGATGG + Intergenic
969749891 4:9101986-9102008 GACTAGGAACTATACGTGGATGG + Intergenic
969789035 4:9479257-9479279 GACTGGGAACTATACGTGGATGG + Intergenic
969793771 4:9510025-9510047 GACTGGGAACTATACGTGGATGG + Intergenic
971027488 4:22602765-22602787 GACTGGGAGCTGTACGTGGATGG + Intergenic
972275104 4:37549780-37549802 GACTGGGGGCTGTACATGGATGG + Intronic
973725579 4:53772379-53772401 CACTGGGAACTAGACATGAAGGG + Intronic
974393978 4:61311351-61311373 TACTGGGAGCTGTATTTGGAAGG + Intronic
974949671 4:68572903-68572925 GACTGGGAGCTGTACGTGGATGG - Intronic
975622027 4:76306031-76306053 GACTGGCATCTTTAGATGGATGG + Intronic
975640645 4:76496546-76496568 GACTGGGAGATTTACCAGGAGGG - Intronic
976970052 4:91093245-91093267 GACTGGGAGTTATACGTGGATGG - Intronic
976990150 4:91355776-91355798 GACTGGGAGCTGTACGTGGATGG - Intronic
978181347 4:105800149-105800171 GACTTGCAGTTATACATGGCTGG + Intronic
979052639 4:115953843-115953865 GACTGGGAGCTGTATGTGGATGG + Intergenic
979901528 4:126225290-126225312 GACTTGGAGTTCTACATGGCTGG - Intergenic
980073188 4:128265011-128265033 GACTGGGAGCTTTATGTGGATGG + Intergenic
980780120 4:137482811-137482833 GACTGAGAGTTATACATGGATGG + Intergenic
981604962 4:146530411-146530433 GACAGGGAACTATATGTGGATGG + Intergenic
986452050 5:7875731-7875753 GATTGGGCTCTTTACATGGAGGG + Intronic
988973653 5:36494060-36494082 GACTGGCAGCTTCACATGCATGG + Intergenic
989557773 5:42817114-42817136 GACTGGGAGCTGTACGTGGATGG + Intronic
991306275 5:65178980-65179002 GACTGTGAGCTGTACGTGGACGG + Intronic
992989511 5:82269928-82269950 GACTGGGAGCTGTACGTGGATGG - Intronic
995473805 5:112528409-112528431 GACTGGGAGTTATACGTGGATGG + Intergenic
995793308 5:115916622-115916644 GACTGGAAGCTCTGCATGCATGG - Intergenic
999126421 5:149249610-149249632 GGCTGGGAGCTGGACAGGGAAGG + Intronic
1000237010 5:159371219-159371241 GACTGTGAGCAGTACGTGGATGG + Intergenic
1000604713 5:163315705-163315727 GACTGGGAGCTGTAAGTGGATGG - Intergenic
1002408162 5:179052672-179052694 GACTGGGAGTTATACGTGGACGG - Intergenic
1006031989 6:31183098-31183120 GACTGGGAGCTGTACGTGGATGG - Intergenic
1006570791 6:35002266-35002288 GACTGGGAGCTGTACGTGGATGG + Intronic
1007686445 6:43669919-43669941 GACTGGGAGCCATCCTTGGTGGG - Intronic
1008123662 6:47645512-47645534 GACTGTGAGCTGTACGTGGACGG + Intergenic
1008582926 6:52922572-52922594 GACTGGGAGCTATACTTGAACGG + Intergenic
1010317945 6:74471955-74471977 GACTGGGAGCTGTACGTGGATGG + Intergenic
1010853626 6:80809980-80810002 GGCTGGGATCTGTACATTGATGG + Intergenic
1011565320 6:88666691-88666713 GACTGGGAGCTGTATGTGGACGG + Intronic
1012977670 6:105797370-105797392 ACCTGTGAGCTAGACATGGAAGG - Intergenic
1015172110 6:130265292-130265314 GACTGAGAGCTGTACGTGGATGG + Intronic
1016243967 6:141961577-141961599 GACTGGGAGCTCTACACTGGTGG + Intergenic
1016275239 6:142342955-142342977 GACTTGCAGATATACATGAATGG + Intronic
1018618926 6:165712173-165712195 CACTGGGAGCTGTGCCTGGAGGG + Intronic
1018771900 6:166977728-166977750 GCCTGGGAGATATACACGAATGG - Intergenic
1020307057 7:6843474-6843496 GACTGGGAACTATACGTGCATGG - Intergenic
1020311533 7:6872318-6872340 GACTGGGAACTATACGTGGATGG - Intergenic
1020323091 7:6954656-6954678 GACTGGGAACTATACGTGGATGG - Intergenic
1022468117 7:30665032-30665054 GACTCGGGGCTATACCTGGGGGG - Intronic
1025858891 7:65308032-65308054 GACTGGTTGCTGTTCATGGATGG + Intergenic
1026296953 7:69061138-69061160 GACTGGGAGCAGTGAATGGAGGG - Intergenic
1029078210 7:97952418-97952440 GACTGGGAACTATACGTGCATGG - Intergenic
1032170740 7:129582591-129582613 GACTGGGAGCTGTACGTGGACGG + Intergenic
1032782492 7:135175132-135175154 GGCTGGGAGCTGTACATGGATGG + Intergenic
1032979387 7:137264532-137264554 GACTGGGAGCTGTACGTGGATGG - Intronic
1033648695 7:143323720-143323742 GATTGGGAGCTACAAAGGGATGG - Intronic
1036239800 8:7072085-7072107 GACTGGGAACTATACATGGATGG + Intergenic
1036262078 8:7249069-7249091 GACTGGGAGCCACACGTGGATGG - Intergenic
1036304512 8:7590489-7590511 GACTGGGAACCACACGTGGATGG + Intergenic
1036314117 8:7707608-7707630 GACTGGGAGCCACACGTGGATGG - Intergenic
1036355365 8:8038481-8038503 GACTGGGAACCACACGTGGATGG + Intergenic
1036816643 8:11907532-11907554 GACTGGGAGCCATACGTGGATGG - Intergenic
1036833370 8:12039061-12039083 GACTGGGAGCCATACGTGGATGG - Intergenic
1036855216 8:12285626-12285648 GACTGGGAGCCATACGTGGATGG - Intergenic
1036903532 8:12689480-12689502 GACTGGGAACTATACGTGGATGG - Intergenic
1038089847 8:24240664-24240686 GACTGTGAGCGGTACGTGGATGG + Intergenic
1038799099 8:30733134-30733156 GACTGGGAACTATACGTGGATGG + Intronic
1039278353 8:35956035-35956057 GACTGGGAGCTGTATGTGGACGG + Intergenic
1040992595 8:53368718-53368740 GACTGGGAGCTATACGTGGATGG - Intergenic
1041030903 8:53734329-53734351 GACTGGGAGCTGTATGTGGATGG + Intronic
1041227324 8:55713393-55713415 GACTGTGAGCAGTACGTGGACGG + Intronic
1041430248 8:57773415-57773437 AAGTGGGAGCTAAACATTGAGGG + Intergenic
1041515653 8:58696200-58696222 GACTGTGAGCGGTACATGGAAGG + Intergenic
1043731591 8:83690728-83690750 AAGTGGGAGCTAAACATGGAGGG + Intergenic
1045495811 8:102707556-102707578 GACTTGGAGGTAGACATGGAAGG + Intergenic
1045889971 8:107144179-107144201 GACTGGGAGAAATTCATTGAGGG - Intergenic
1046967431 8:120183223-120183245 AAGTGGGAGATATACATGGACGG + Intronic
1052067843 9:24044735-24044757 GACTGGGAGATCTACTTGCAAGG + Intergenic
1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG + Intergenic
1053618764 9:39795076-39795098 GACTGTGAGGTATTCATGGTGGG + Intergenic
1053876944 9:42554438-42554460 GACTGTGAGGTATTCATGGTGGG + Intergenic
1053895732 9:42740269-42740291 GACTGTGAGGTATTCATGGTGGG - Intergenic
1054234754 9:62547284-62547306 GACTGTGAGGTATTCATGGTGGG - Intergenic
1054265390 9:62912353-62912375 GACTGTGAGGTATTCATGGTGGG - Intergenic
1056865815 9:90226589-90226611 GACTGGGAACTATATGTGGATGG + Intergenic
1056917204 9:90756313-90756335 GACTGGGAACTATATGTGGATGG - Intergenic
1062224119 9:135439466-135439488 GACTGGGAACTATACGTGGACGG - Intergenic
1185909937 X:3971944-3971966 GACTGGGAGTTGTACGTGGACGG + Intergenic
1186558539 X:10586402-10586424 GACCGAGAGCTGTACGTGGATGG - Intronic
1189067380 X:37824790-37824812 GATTGGGAGTTATTCAAGGAGGG - Intronic
1190314800 X:49143734-49143756 GACTGGGAGCTGTACGTGGACGG - Intergenic
1190425869 X:50334189-50334211 GACTGGGAGTTATACATGGACGG - Intronic
1191036063 X:56027681-56027703 GACTGGGAGTTATACGTAGACGG - Intergenic
1191707270 X:64106232-64106254 GAATTGGGACTATACATGGAAGG + Intergenic
1193717520 X:84949811-84949833 GACTGTGAGCAGTACATGGACGG + Intergenic
1194400525 X:93434217-93434239 GACTGGGTACTATACGTGGATGG + Intergenic
1196422819 X:115540373-115540395 GACTGTGAGCAGTACATGGACGG - Intergenic
1196869598 X:120100103-120100125 GACTGGGAGCTGTACGTGCATGG + Intergenic
1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG + Intronic
1198469661 X:136934587-136934609 GGCTGGGAGCTATACGTGGATGG - Intergenic
1198970043 X:142269699-142269721 GACTGGGAGTTATACATGGACGG + Intergenic
1200308560 X:155053972-155053994 GACCGGGAGCTATTCCAGGAGGG + Intronic
1200394101 X:155973156-155973178 GACTGGGAGTTATACATGGACGG - Intergenic
1200620180 Y:5435103-5435125 AATTGGGACCTATACATGAAAGG + Intronic
1200699216 Y:6387778-6387800 GATTTGGAGCTGTACATGGATGG + Intergenic
1200943358 Y:8807489-8807511 GACTGGGAGTTATACATGGAGGG + Intergenic
1200948261 Y:8867173-8867195 GACTGGGAACTATATGTGGATGG + Intergenic
1200983635 Y:9284697-9284719 GACTGGGAGGTATATGTGGGTGG - Intergenic
1201034895 Y:9776920-9776942 GATTTGGAGCTGTACATGGATGG - Intergenic
1201270332 Y:12247758-12247780 GACTGGGAGTTATACATGGACGG + Intergenic
1201680535 Y:16640307-16640329 GACTGGGAGTTATACGTGGACGG - Intergenic
1202037270 Y:20647731-20647753 GACTAGGAGCTGTGCATGGATGG + Intergenic
1202126735 Y:21574991-21575013 GACTGGGAGGTATATGTGGGTGG + Intergenic