ID: 969646982

View in Genome Browser
Species Human (GRCh38)
Location 4:8436481-8436503
Sequence CTGTTAAGATCTAGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969646974_969646982 15 Left 969646974 4:8436443-8436465 CCCTCCAACTGCATGGAGAATTA 0: 1
1: 1
2: 13
3: 27
4: 201
Right 969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG 0: 1
1: 0
2: 2
3: 26
4: 277
969646972_969646982 24 Left 969646972 4:8436434-8436456 CCTGTTTAACCCTCCAACTGCAT 0: 1
1: 4
2: 8
3: 33
4: 129
Right 969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG 0: 1
1: 0
2: 2
3: 26
4: 277
969646976_969646982 11 Left 969646976 4:8436447-8436469 CCAACTGCATGGAGAATTATATT 0: 1
1: 0
2: 1
3: 32
4: 199
Right 969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG 0: 1
1: 0
2: 2
3: 26
4: 277
969646975_969646982 14 Left 969646975 4:8436444-8436466 CCTCCAACTGCATGGAGAATTAT 0: 1
1: 1
2: 13
3: 30
4: 173
Right 969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG 0: 1
1: 0
2: 2
3: 26
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969646982 Original CRISPR CTGTTAAGATCTAGGAAAAA GGG Intronic
900909015 1:5581035-5581057 GTGTCAAGATCTTGGTAAAAAGG + Intergenic
901358447 1:8673607-8673629 CTGTCAAGATCTTGGAAAGAAGG + Intronic
906803947 1:48761641-48761663 CAGTGCAGATCTAGGAACAAGGG + Intronic
907610230 1:55861748-55861770 CTGCTAAGATCTGTGAAAAGTGG + Intergenic
907958853 1:59259272-59259294 GGGTTAAGATCTAGGCACAAAGG - Intergenic
910035381 1:82782103-82782125 CTATTAAAAACTAGGAAATAAGG + Intergenic
910819410 1:91329662-91329684 CCATTAAGATCAAGTAAAAAAGG - Intronic
911116589 1:94251934-94251956 ATGTTAAGTTCTATGAAAGAAGG + Intronic
911440065 1:97914911-97914933 CTGTTAGAATCTATGAGAAAGGG - Intronic
916102970 1:161408677-161408699 CTGTTAAACTCCAGGAAAAAGGG - Intergenic
916951789 1:169787901-169787923 CTGATAAGATATAGGAAAATGGG - Intronic
917180326 1:172289221-172289243 CTCTTAAAATCTAGGGAAAAAGG + Intronic
917190735 1:172415828-172415850 CTGTTAAAATCTCACAAAAAAGG - Intronic
918488627 1:185055831-185055853 ATTTTAAGATCAAGGACAAAAGG - Intronic
921620167 1:217316495-217316517 CTATCAGGATCTAGGTAAAAAGG + Intergenic
922247864 1:223818038-223818060 CTGTTTACATAAAGGAAAAATGG + Intronic
922909377 1:229202987-229203009 CTGGTTAGAACTACGAAAAAGGG - Intergenic
923078507 1:230631843-230631865 TTGATAAGTTTTAGGAAAAAAGG + Intergenic
924703182 1:246474896-246474918 CTGGTAAGAACTAAGAAAATTGG + Intronic
1065415995 10:25486939-25486961 CTGTTAATACCTTGGAAAAGGGG + Intronic
1066046101 10:31596887-31596909 ATGTAAAGATCTAGTAATAAAGG + Intergenic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1073637569 10:105215371-105215393 CTCTTGAGATCTTGGAAAGAAGG + Intronic
1073748499 10:106497171-106497193 CTGCTAAGATGTAGGCATAAAGG + Intergenic
1075402100 10:122168450-122168472 CTGGTGATATCTAGGAATAATGG - Intronic
1075828959 10:125387666-125387688 TTGTTAAGATATATGACAAAGGG - Intergenic
1076245905 10:128947545-128947567 CTTTTAACATATGGGAAAAATGG + Intergenic
1079513287 11:21236179-21236201 CTCAGAAGATCAAGGAAAAATGG - Intronic
1079693361 11:23447478-23447500 TTGTAAAGATCAAGAAAAAAAGG + Intergenic
1079989135 11:27228906-27228928 ATGATAATATCTAGGACAAAAGG + Intergenic
1080335901 11:31195990-31196012 ATGTTAAGATCTTGGATGAAAGG - Intronic
1080517560 11:33038435-33038457 CTGTTAAGATCTACAAAGAATGG - Intergenic
1082230284 11:49756706-49756728 ATATTAAGATGTAGGAAACAAGG - Intergenic
1082930669 11:58601555-58601577 CCCATAAGAGCTAGGAAAAAAGG - Intronic
1083313220 11:61796646-61796668 CCATTAAGATCAAGTAAAAAAGG - Exonic
1084520966 11:69662570-69662592 TTCTTAAGATCTGAGAAAAATGG - Intronic
1085504292 11:77047971-77047993 CTTTTAAGTTCTAGGATACATGG + Intergenic
1086539977 11:87897437-87897459 TTTTTAAGATCTGGGAAATAGGG - Intergenic
1087357464 11:97112638-97112660 CTTTTTAGATTTAGGAAGAAAGG - Intergenic
1088173306 11:107019975-107019997 CATTTAAGATCTGGGGAAAAAGG - Intergenic
1088215741 11:107506832-107506854 CTCTGAAGATGTAGGAGAAAAGG + Intronic
1088833010 11:113554216-113554238 CTGTTATGAGCTAGGAGACAGGG + Intergenic
1092445210 12:8549465-8549487 CTGTCAAGAAGAAGGAAAAATGG + Intergenic
1093418982 12:18952760-18952782 CTGTAAAGAAATAAGAAAAAGGG - Intergenic
1094038585 12:26098207-26098229 CTTTTAAGATGGTGGAAAAACGG + Intergenic
1095621801 12:44265229-44265251 CTGTTATGATCCAGAAACAAAGG + Intronic
1098695309 12:73546033-73546055 CTGTTAAATTTTAGAAAAAAAGG - Intergenic
1098936424 12:76484700-76484722 CTGTTTAGATCTGGGAGAAGTGG - Intronic
1099404221 12:82240332-82240354 CTGTTAAAAAGTAGGCAAAAAGG - Intronic
1100607661 12:96165103-96165125 CTGATAAGATCCTGGAAAACAGG + Intergenic
1100887370 12:99086240-99086262 CTAATCAGATATAGGAAAAATGG + Intronic
1102502691 12:113363508-113363530 ATGTTTATATCTAGGAAGAATGG - Intronic
1103229221 12:119314059-119314081 CCCTTAAGATCTAGATAAAATGG + Intergenic
1105901358 13:24757161-24757183 GTGTTAGATTCTAGGAAAAAAGG + Intergenic
1106029556 13:25987773-25987795 CTGTTAAGATTTAAGGTAAATGG - Intronic
1109482710 13:62977355-62977377 GTGTTAAGAAGTAGGACAAAGGG + Intergenic
1111353685 13:87068275-87068297 CTCTTAAGATATAGGAATTATGG - Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111704876 13:91735884-91735906 CTATCCACATCTAGGAAAAATGG + Intronic
1111712800 13:91838525-91838547 ATGTTAAAATCAAGGAGAAAAGG + Intronic
1111795555 13:92914866-92914888 ATGTCAAGATCTATAAAAAAGGG + Intergenic
1112046586 13:95603857-95603879 CTGGGAGGATCTAGGTAAAATGG - Intronic
1115415933 14:33133758-33133780 TTGTAAACCTCTAGGAAAAAAGG - Intronic
1117403221 14:55376811-55376833 CTGCTAAGAGCAAGGAAAAAAGG + Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1119334006 14:73817359-73817381 CTTTTAAAAACTAGAAAAAAGGG + Intergenic
1120102321 14:80459593-80459615 CTGTTAAGTTCAATGAAACATGG - Intergenic
1121430878 14:93887499-93887521 CTGTTAGAATCAAGGAAATATGG - Intergenic
1121658021 14:95612474-95612496 ATGTTAAGGGCTATGAAAAAAGG - Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1124987592 15:34636857-34636879 ATGTTAAAATCAAGGAGAAAGGG + Intergenic
1125330703 15:38579562-38579584 CTTTTAAAATCAAAGAAAAAAGG - Intergenic
1126525245 15:49646826-49646848 CTGGTAAGAGCGAGGAAGAAAGG - Exonic
1128059332 15:64724692-64724714 CTCCTAAGATCTAGGATGAAGGG + Intergenic
1130399419 15:83535591-83535613 CTGTTGAGATCTGGGAACACGGG + Intronic
1131309565 15:91277214-91277236 CTGTTAAAACCTAGCAAAAGAGG - Intronic
1133483257 16:6192520-6192542 CAGTTAAGAGATAGGTAAAACGG - Intronic
1133599810 16:7328177-7328199 CTGTTAAGATCTGGGAAAGGAGG + Intronic
1135926223 16:26696331-26696353 CTGTTAAGATTAATTAAAAAAGG + Intergenic
1139011502 16:62640184-62640206 CTGACAGGATCTAGGAGAAAGGG + Intergenic
1140193120 16:72834932-72834954 CTGTTAAGAGTTAGGAACAGAGG - Intronic
1140702624 16:77596168-77596190 CTGTTAAGAAATAGATAAAAAGG + Intergenic
1140724982 16:77803758-77803780 CTGTCACGTTGTAGGAAAAATGG + Intronic
1143888508 17:10084765-10084787 CTATTAAGATATAGGGAAAGGGG - Intronic
1145880461 17:28349163-28349185 CTGTAAAGGTTTAGGCAAAATGG + Intronic
1146517683 17:33502094-33502116 CTGTCAAGATCTAGGGGGAAGGG + Intronic
1146659490 17:34654913-34654935 CTCTTCAGATCTAGGCAAAAGGG + Intergenic
1146897501 17:36555149-36555171 CTTTTAAAAACTAGGAAAGATGG - Intronic
1149186640 17:54005553-54005575 ATCTTAAAATCTAAGAAAAATGG - Intergenic
1149240788 17:54646350-54646372 CTTTTAAGATCTCAGAAGAAAGG - Intergenic
1149289632 17:55204995-55205017 CTGCTAAGAACTACTAAAAAGGG - Intergenic
1149811393 17:59676941-59676963 CAGTTTCAATCTAGGAAAAAAGG - Exonic
1150206017 17:63408237-63408259 CTGATTAGATGTAGGAAATAAGG + Intronic
1151157058 17:72132499-72132521 CTGTCAAAATCTAGGAAACCAGG + Intergenic
1151412645 17:73941476-73941498 CTGTAATTTTCTAGGAAAAAGGG - Intergenic
1153632197 18:7081697-7081719 CTGTAAAGATCTAGAAACAATGG + Intronic
1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG + Intergenic
1155263364 18:24067014-24067036 ATGCTAAAATCTAGAAAAAAGGG + Intronic
1155263502 18:24068343-24068365 ATGCTAAAATCTAGAAAAAAGGG + Intronic
1156495013 18:37519954-37519976 TTGTTAAGACCTGGGAAAACGGG + Intronic
1157053706 18:44199451-44199473 TTGTTGAGATCCAGGAAAAGTGG + Intergenic
1158442216 18:57486423-57486445 CCGTGAAGAACTAGAAAAAAGGG - Exonic
1160322482 18:77909172-77909194 GTTAGAAGATCTAGGAAAAATGG + Intergenic
1161200308 19:3010954-3010976 CTGGGGAGATCTAGGAAAAGGGG - Intronic
1163012782 19:14435469-14435491 CGGTTCTGACCTAGGAAAAATGG + Intronic
1164296285 19:23913129-23913151 CTATTAAAAACTTGGAAAAAAGG + Intergenic
1165854518 19:38871451-38871473 CTGTTAGGACCTAGGAATACAGG + Intronic
1166423999 19:42659813-42659835 CTGTGCAGACTTAGGAAAAATGG - Intronic
1166431877 19:42734841-42734863 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166434993 19:42760058-42760080 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166447839 19:42873821-42873843 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166470718 19:43077404-43077426 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166481831 19:43180934-43180956 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166484302 19:43200052-43200074 CTGTGCAGAGTTAGGAAAAATGG + Intronic
1166491422 19:43263930-43263952 CTGTGCAGAATTAGGAAAAATGG + Intronic
1167900747 19:52620372-52620394 CTGTTCAGTTCTAAGAAAACAGG + Intronic
1168485268 19:56756356-56756378 AAGTTAAGATCAATGAAAAATGG + Intergenic
1168568798 19:57446886-57446908 CTGTAAAAATGTATGAAAAATGG + Intronic
925051067 2:816034-816056 CTGTTTAGATCTGGAACAAAAGG + Intergenic
926234557 2:11029463-11029485 ATGTGAACATCAAGGAAAAAGGG - Intergenic
926693413 2:15753611-15753633 CTGTTGAGATTTAGGACAAGAGG - Intergenic
927273699 2:21242113-21242135 ATGTCAAGAGCTAGGAAAAAAGG - Intergenic
927757045 2:25717182-25717204 ATGTTAGCATCTAGGAAAAAAGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930066863 2:47334380-47334402 CTGTGCAGATGTAGGAAAAAGGG - Intergenic
930118851 2:47743356-47743378 TTGTAAATATCTAGGAAAAGTGG + Intronic
930234682 2:48877347-48877369 CTGTTGAGATATAGGTACAAGGG + Intergenic
930280666 2:49365517-49365539 CTCTTCAGATAAAGGAAAAAAGG + Intergenic
931257833 2:60589384-60589406 GTGTTTAGATCCAGGACAAAGGG + Intergenic
936277785 2:111115684-111115706 CTGTTGCAGTCTAGGAAAAATGG + Intronic
937411987 2:121684765-121684787 CTGTTAAACTCTAGAAAAAAGGG - Intergenic
937517058 2:122667338-122667360 CTGTCAAGATTTAGGCAATATGG + Intergenic
938275489 2:130017411-130017433 CTTGAAAGATCTGGGAAAAAAGG - Intergenic
938439876 2:131319884-131319906 CTTGAAAGATCTGGGAAAAAAGG + Intronic
939490749 2:142873732-142873754 AAGTTCTGATCTAGGAAAAAGGG + Intergenic
941245371 2:163089587-163089609 CTGTTAAGATCAAGTAAATTAGG + Intergenic
941521303 2:166547502-166547524 CTGTTAAAATATAGAAAAAATGG - Intergenic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942494887 2:176529491-176529513 ATGTTCAAATATAGGAAAAAAGG - Intergenic
944321890 2:198355705-198355727 CTCTTAACATCTTGGAAAATGGG - Intronic
944498144 2:200329418-200329440 CTGAAGAGCTCTAGGAAAAATGG - Exonic
945278622 2:208014012-208014034 GTGATAAGATCTAAGCAAAAAGG + Intronic
946223060 2:218245770-218245792 TTTTTAAGATTTAAGAAAAATGG - Intronic
946463772 2:219893653-219893675 CTTTTAAGAGCTAGGAAGTAAGG - Intergenic
946707454 2:222472615-222472637 CTGCTAAGATGTAGGCATAAAGG - Intronic
946883987 2:224204862-224204884 TTGATAAGATTTAGGCAAAATGG - Intergenic
947116057 2:226771988-226772010 CTGTTAAATTCTAGGAAACTGGG - Intronic
948233485 2:236369609-236369631 CTGTTATGTTCTAGAAAATATGG - Intronic
1169036749 20:2459374-2459396 GTGATAAGAACCAGGAAAAAAGG + Intergenic
1169651938 20:7878513-7878535 CTGTTAAGATGTAGGCCTAAAGG - Intergenic
1170652217 20:18253083-18253105 TTGTTAAGATTTATGAAGAAAGG + Intergenic
1172516080 20:35534577-35534599 ATGCTAAGATCTGGAAAAAATGG - Intergenic
1172638402 20:36425434-36425456 CTGGCAAGATCTGGGAAAACTGG + Intronic
1173759962 20:45550771-45550793 ATGTGAAAATATAGGAAAAATGG + Intergenic
1173955425 20:47028693-47028715 CTGTAAAGCTCTAGGACACAGGG + Intronic
1174396659 20:50250968-50250990 GTGTTCAGATCTAGGAAATGGGG + Intergenic
1175612368 20:60362429-60362451 CTGTTGAGATCTGTTAAAAATGG - Intergenic
1175662641 20:60828357-60828379 CTGTTAAGAACTAGGAATAGAGG - Intergenic
1177726514 21:24974879-24974901 CTCTTAAGATCAAGAAAAAGAGG + Intergenic
1178936260 21:36864817-36864839 GTGTTAACATCTATAAAAAATGG - Intronic
1182903294 22:33916975-33916997 TTGTTGTGGTCTAGGAAAAATGG - Intronic
949821242 3:8117684-8117706 CAGTAAAGATGTAGAAAAAATGG - Intergenic
951120366 3:18919739-18919761 CTGGTTAGAGCTAGAAAAAATGG + Intergenic
951468500 3:23029639-23029661 CATTTAAAATCTAGAAAAAATGG - Intergenic
951641592 3:24842740-24842762 CTCTTAAGTTCTTGGAAGAAAGG - Intergenic
951712311 3:25596331-25596353 CTGTTAAAATATATGAAAATTGG + Intronic
953466644 3:43127549-43127571 TTGTTGAGAACTAGGAAAAGAGG - Intergenic
954808786 3:53235455-53235477 CTAATAAGATCTAGAAAAATGGG + Intronic
955204446 3:56882860-56882882 CTATTAAGCTCTAGGATAATTGG + Intronic
955882865 3:63566249-63566271 TGGTAAAGATCTGGGAAAAATGG + Intronic
956536501 3:70282612-70282634 ATGTTTAGATCTAGAAAGAAAGG - Intergenic
956755426 3:72381209-72381231 CTGTTAGAATCTGTGAAAAAGGG - Intronic
957391368 3:79576376-79576398 CTGGTAAGATTTTGGAAATATGG - Intronic
958101222 3:89013498-89013520 CTGTTAACATTTCGGAGAAAGGG + Intergenic
958450278 3:94264831-94264853 GTGTTAAGCTCTATGACAAAGGG - Intergenic
960020706 3:112948850-112948872 ATCTTAAGCTCTTGGAAAAAAGG - Intronic
960651027 3:119950377-119950399 ATGTGAAGATCTAGGGAAGATGG + Intronic
960843139 3:121980481-121980503 CTGTTAAAATCCAGCAAAACAGG + Intergenic
962872774 3:139512541-139512563 CTGTTAATACCTAGGAGAGATGG + Intergenic
966061897 3:175768022-175768044 CTTTTAAGATCCAGGGACAATGG - Intronic
968251932 3:197225674-197225696 CAGTTAAGATATAGTAGAAAAGG - Intronic
968925613 4:3545774-3545796 CTGCTAAGGTCTACGAAGAAGGG + Intergenic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
970835797 4:20405377-20405399 GTTTTGAAATCTAGGAAAAAAGG + Intronic
971260221 4:25050299-25050321 CCGTGAATATCGAGGAAAAATGG - Intergenic
973087792 4:46089660-46089682 TTGTTAAGAAGTAGGAAAATAGG + Intronic
973349137 4:49090163-49090185 CTGTGAAGATCTACAAAAAGAGG - Intergenic
973546965 4:51991741-51991763 TTGTAAAGATCTAGGATTAAGGG - Intergenic
973938899 4:55882423-55882445 CTGTTGAGTGCCAGGAAAAAAGG + Intronic
976273724 4:83255197-83255219 TTGTTAAGATCTCTGAAACATGG - Intergenic
977097491 4:92764616-92764638 GTGTTAAGTTCTATAAAAAAGGG - Intronic
977474439 4:97487535-97487557 ATGTTAAGATGTAAAAAAAATGG - Intronic
977923445 4:102671280-102671302 CTGTGATGAACTAGGAATAATGG - Exonic
978545294 4:109865543-109865565 TTGTTAAGATCAAGAAAATATGG + Intronic
979223083 4:118251938-118251960 TTGTTAAGTTTTAGAAAAAAAGG - Intronic
980097716 4:128510460-128510482 GTGTTTAGCTCTGGGAAAAAGGG + Intergenic
980455761 4:133040513-133040535 CTGTAAGGAGCTGGGAAAAAAGG - Intergenic
980916859 4:139041893-139041915 CACTTAACATCTAGGAGAAATGG + Intronic
985120169 4:186631960-186631982 CTGTTAAGGTGTGGGACAAAGGG - Intronic
986191553 5:5500995-5501017 CTGTTCAAATCTAGGGCAAATGG - Intergenic
986826617 5:11529115-11529137 CTGTGAAGATCTAGGAAATAAGG + Intronic
987909846 5:24127076-24127098 CTGTAAAAATCTAGAAGAAATGG - Intronic
988366487 5:30307241-30307263 TTGTTAGGCTCAAGGAAAAAGGG - Intergenic
990496808 5:56356379-56356401 CTGTTAAGCACTAGATAAAATGG - Intergenic
990826618 5:59907149-59907171 CTGGCAAGATTTAGGAGAAAAGG - Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991453159 5:66774173-66774195 GTGCTCAGATCAAGGAAAAAGGG + Intronic
993011258 5:82485598-82485620 TTGTTAAGATTTAGAAACAAAGG - Intergenic
993890829 5:93469815-93469837 CTGTTAATATCAATGCAAAAGGG + Intergenic
993930991 5:93938776-93938798 TTGTTAATTTCCAGGAAAAAAGG + Intronic
994103827 5:95923295-95923317 ATGATAAGAACAAGGAAAAATGG - Intronic
994752813 5:103759791-103759813 GTTTTAAGATCTGGGAAAAAGGG + Intergenic
994914058 5:105949512-105949534 CTGTTAAGTTATAAGAAAATTGG + Intergenic
995196362 5:109373621-109373643 CTTTTAAAATCTAGAACAAATGG - Intronic
995857066 5:116604683-116604705 ATTTTAGTATCTAGGAAAAAAGG - Intergenic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997841347 5:137243205-137243227 CTGTTAAGAGAAAGGAAACATGG - Intronic
998319651 5:141216674-141216696 CTTTTAAGAACCAGGAATAAAGG - Exonic
998654405 5:144160560-144160582 CTGTAAACAACAAGGAAAAAGGG + Intronic
998786842 5:145720647-145720669 CTGTGAAAATTTAGGTAAAAGGG + Intronic
1000070678 5:157738001-157738023 CTGTTATGTTCAAAGAAAAATGG + Intronic
1000589397 5:163140361-163140383 CTGAGAAGAACTAGGAAAACAGG - Intergenic
1001752484 5:174142274-174142296 CTGATAAGACCTAGGACAAAGGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004014178 6:11717389-11717411 CTGTTCAGATCTTGCAAAGATGG - Intronic
1004612529 6:17257175-17257197 CTGCTAAAATGTAGGAAGAAAGG - Intergenic
1006790085 6:36694435-36694457 ATGTTAACATTTAGGAACAATGG - Intergenic
1006800879 6:36758974-36758996 CTGTTAAGATGAGGGCAAAATGG + Intronic
1008125053 6:47658725-47658747 CTGTTAACATTTAGGATAAATGG - Intronic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1008258119 6:49329740-49329762 CTGTGAAGAACTAGAAAACAGGG - Intergenic
1009531059 6:64816116-64816138 CAATTAAGATCTTGGAGAAAGGG + Intronic
1009553777 6:65134906-65134928 CTGTCCAGACCTAGAAAAAATGG + Intronic
1010640596 6:78321707-78321729 TTATAAAGATCTAGGAGAAATGG - Intergenic
1011064283 6:83308736-83308758 CTGTTAAGTTCTATGAAAGCAGG - Intronic
1011325412 6:86145982-86146004 CTCTTGAGATCTAGAAATAATGG - Intergenic
1011399277 6:86942140-86942162 CTGTTAGCATCCAAGAAAAATGG + Intronic
1011544120 6:88465854-88465876 CTGTTAAGAACTATTAATAAGGG + Intergenic
1012605131 6:101148674-101148696 CTGTGTAGATCTTGGTAAAAAGG + Intergenic
1013478451 6:110531030-110531052 CTGCTAAGATGTAGGCATAAAGG - Intergenic
1014103534 6:117537910-117537932 CTCTTAAAATCTAAGATAAAGGG - Intronic
1017993243 6:159508560-159508582 GTGTTAATCTCAAGGAAAAATGG + Intergenic
1021565869 7:22015725-22015747 ATAGTAAGATCTAGGAAAAAGGG + Intergenic
1022558094 7:31320409-31320431 CTGTTAGGGACTAGCAAAAAAGG - Intergenic
1024125883 7:46294558-46294580 CTGTTAAAATTTATGACAAATGG + Intergenic
1027756398 7:82218297-82218319 CACTTAAGATGTAGGAAAACAGG + Intronic
1027826544 7:83123789-83123811 CTGTTAAGAAATAGGCAAAAGGG + Intronic
1028756691 7:94443120-94443142 ATGCTAAGATATAGGAAGAAGGG - Intergenic
1029301062 7:99582682-99582704 TTCTTAATATCCAGGAAAAAAGG - Intronic
1031083078 7:117277250-117277272 CTGTACAGATCAAGAAAAAAAGG - Exonic
1031510356 7:122641199-122641221 CTGTTATGATCAAGGATTAACGG - Intronic
1033121483 7:138670304-138670326 CTGTTAAGATATAGGCTTAAAGG + Intronic
1036067514 8:5398718-5398740 TTGATAAGATATAGCAAAAATGG + Intergenic
1036293113 8:7512496-7512518 CTTTTAACATATAGGAACAAAGG - Intergenic
1036329446 8:7808504-7808526 CTTTTAACATATAGGAACAAAGG + Intergenic
1036812639 8:11878070-11878092 CCTTTTAGATCTAGGTAAAATGG + Intergenic
1036972570 8:13371057-13371079 GTTTTCAGATCAAGGAAAAATGG + Intronic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1040048481 8:42988036-42988058 ATGTAAAGCTATAGGAAAAAGGG - Intronic
1040064256 8:43132021-43132043 ATGTTAAGATTTACTAAAAAAGG - Intergenic
1041014164 8:53573989-53574011 CTGTTGACATCTGGGAAGAAGGG - Intergenic
1041875118 8:62678957-62678979 CTCTTAAGATATATGAAAAAAGG + Intronic
1043246181 8:78004986-78005008 TTCTTAATATCTAGGAAATAAGG - Intergenic
1044063602 8:87670474-87670496 CTATTAAGATTAGGGAAAAAAGG + Intergenic
1044165612 8:88979737-88979759 CTGTTAAGAACTCGGAAAGAGGG + Intergenic
1044855313 8:96469192-96469214 CTTTTAAGATCTAGGACATACGG - Intergenic
1045705499 8:104917801-104917823 TTCTTAAGACCAAGGAAAAAGGG + Intronic
1045760157 8:105596108-105596130 CTGTTAAGATTTATGGCAAATGG + Intronic
1045988865 8:108282682-108282704 CTGTACAGTACTAGGAAAAAAGG + Intronic
1046656800 8:116903787-116903809 GTGTTATGTTCTAGGAACAATGG - Intergenic
1047025195 8:120816087-120816109 TTGTAAAGAGCTAGGAAAGAGGG + Intergenic
1048908034 8:139107203-139107225 CTGTCAAGAACCAGGAAGAAGGG - Intergenic
1049880604 8:145059750-145059772 CTCTTAACATCCAGGAAAACAGG + Intergenic
1051028127 9:12638878-12638900 CTGGTAAGACTTTGGAAAAAAGG - Intergenic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1051204937 9:14677166-14677188 ATGTTTACATCCAGGAAAAATGG - Intronic
1051803646 9:20965693-20965715 TTGCTAGGATCTTGGAAAAATGG - Intronic
1051825817 9:21218223-21218245 ATTTTAAGATCAAGCAAAAATGG + Intronic
1052607842 9:30728241-30728263 CTGATAAGAGCTATGAAGAATGG - Intergenic
1053607513 9:39676019-39676041 ATTTTAAGATCTAGATAAAATGG - Intergenic
1053800495 9:41760955-41760977 CTGCTAAGGTCTACGAAGAAGGG + Intergenic
1053865364 9:42432377-42432399 ATTTTAAGATCTAGATAAAATGG - Intergenic
1054144697 9:61553880-61553902 CTGCTAAGGTCTACGAAGAAGGG - Intergenic
1054188925 9:61973107-61973129 CTGCTAAGGTCTACGAAGAAGGG + Intergenic
1054246022 9:62666390-62666412 ATTTTAAGATCTAGATAAAATGG + Intergenic
1054464384 9:65484837-65484859 CTGCTAAGGTCTACGAAGAAGGG - Intergenic
1054560144 9:66700923-66700945 ATTTTAAGATCTAGATAAAATGG + Intergenic
1054649593 9:67615510-67615532 CTGCTAAGGTCTACGAAGAAGGG - Intergenic
1056463689 9:86833064-86833086 CATTGAAGATCTAGGAAAAAAGG - Intergenic
1056821299 9:89843968-89843990 GTGCTAAGTACTAGGAAAAAAGG + Intergenic
1057944121 9:99309703-99309725 CTGTGAAGATCTGTGAAACATGG - Intergenic
1058840229 9:108899960-108899982 CTGTGAAGAGTTAGGTAAAATGG - Intronic
1059286310 9:113174800-113174822 CTATTAAGAGCTAGGGAAATTGG + Intronic
1186299870 X:8188772-8188794 CTCTTGAAATCTAGTAAAAATGG + Intergenic
1187042030 X:15606853-15606875 CTTTTTACATTTAGGAAAAAAGG - Intergenic
1188872517 X:35390428-35390450 CTGTTTAGGTATAGGAAAGAAGG + Intergenic
1189160117 X:38802726-38802748 CTGTTAAGTTTTAGAGAAAAGGG + Exonic
1189867007 X:45341120-45341142 CTGGCAAGATCTTGGAGAAAAGG + Intergenic
1192925712 X:75752971-75752993 CTGTTAAGATATAATAATAATGG + Intergenic
1193240603 X:79164680-79164702 CTGTAAAGGCATAGGAAAAATGG + Intergenic
1194345725 X:92762001-92762023 TTGTCAAGATCTAACAAAAAGGG - Intergenic
1199414223 X:147560951-147560973 CTCTGAAGATCAAGGAAATAAGG + Intergenic
1199908246 X:152257716-152257738 CTGTTAAGAGCTTAGCAAAAGGG + Intronic
1200541998 Y:4469263-4469285 CTTTTTATATCTAGGAAAAATGG + Intergenic
1200654071 Y:5878652-5878674 TTGTCAAGATCTAACAAAAAGGG - Intergenic