ID: 969647648

View in Genome Browser
Species Human (GRCh38)
Location 4:8441753-8441775
Sequence CCCGTAGGGTACTCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 10, 2: 12, 3: 13, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969647642_969647648 -8 Left 969647642 4:8441738-8441760 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 15
3: 10
4: 147
Right 969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG 0: 1
1: 10
2: 12
3: 13
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969647648 Original CRISPR CCCGTAGGGTACTCAAAGTC CGG Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904748837 1:32728128-32728150 CCCTTAAGGAACTCACAGTCTGG + Intergenic
912328348 1:108791580-108791602 GAAGTAGGGGACTCAAAGTCAGG - Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1083590622 11:63891849-63891871 CCAGCAGGGTACTGAAAGCCTGG - Intronic
1088984725 11:114895556-114895578 CCCGTAAGGAACTTAGAGTCTGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120834147 14:89025962-89025984 CCCGCAGGATAATTAAAGTCAGG + Intergenic
1121238703 14:92412453-92412475 CCAGTAGGCTACTCAGAGTGCGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1146552210 17:33791116-33791138 CCCTTTGGCTGCTCAAAGTCAGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG + Intergenic
926226225 2:10968707-10968729 CCTGTAAGCTACTCGAAGTCGGG - Intergenic
935818227 2:106867829-106867851 CCCGTGGAGGACTCAAAGTCAGG + Intronic
948150063 2:235737992-235738014 CCTGTAGGGCACTCAGCGTCCGG + Intronic
1169790909 20:9409721-9409743 TCCAAAGTGTACTCAAAGTCAGG + Intronic
1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949878266 3:8641264-8641286 CCTTTGGGGTACTCCAAGTCTGG - Intronic
953293146 3:41686731-41686753 CTCCAAGGGTACTCAAAGTGAGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
959012108 3:101089612-101089634 CCCGTAGGGTATTTAAAGTTTGG - Intergenic
965788902 3:172366600-172366622 CCCTTAAGGAACTCACAGTCTGG + Intronic
967406947 3:189127139-189127161 TCCGTAGAGTCCTCAGAGTCTGG + Intronic
968293104 3:197554331-197554353 TCTGTAGGGTGCTCACAGTCCGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
975379655 4:73684395-73684417 CCCTCAGGGTTCTCAAACTCTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
986915506 5:12614799-12614821 CCAGAAGTATACTCAAAGTCTGG - Intergenic
992213697 5:74505559-74505581 CCCATGGCGTACTCAAATTCAGG + Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
999075592 5:148792649-148792671 ACCGTAGGTTCCTGAAAGTCAGG - Intergenic
1001966927 5:175916558-175916580 CAGGTAGGGAACTCAAAGACTGG - Intergenic
1002446797 5:179295050-179295072 CCAGTAGGGTGCTCAAGGCCTGG - Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG + Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1185865994 X:3624502-3624524 CCAGAAGCGTAATCAAAGTCTGG - Intronic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1195719335 X:107851466-107851488 GCCGTAGGGTAATGCAAGTCTGG - Intronic
1200372937 X:155746690-155746712 CACATTGGGTACTCAAATTCTGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic