ID: 969648371

View in Genome Browser
Species Human (GRCh38)
Location 4:8447576-8447598
Sequence CTGTCTACTCACCTTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969648361_969648371 23 Left 969648361 4:8447530-8447552 CCCACTAGCAGTGTGGTCTTGGG 0: 1
1: 0
2: 15
3: 120
4: 518
Right 969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG 0: 1
1: 0
2: 2
3: 18
4: 265
969648363_969648371 22 Left 969648363 4:8447531-8447553 CCACTAGCAGTGTGGTCTTGGGG 0: 1
1: 0
2: 2
3: 26
4: 202
Right 969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG 0: 1
1: 0
2: 2
3: 18
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969648371 Original CRISPR CTGTCTACTCACCTTGAAAT GGG Intronic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
902955334 1:19921345-19921367 CTGTTTCCTCACCTAGAAAACGG - Intronic
903135960 1:21309359-21309381 CTGTCTTCTCACCTGTAAAGTGG + Intronic
903351937 1:22722528-22722550 ATGGCTCCTCACCTTGAAATGGG + Intronic
903424559 1:23244290-23244312 CAGTCTCCTCATCTGGAAATTGG + Intergenic
904131556 1:28279411-28279433 CTGTTTACTCACCTGTAAAATGG + Intronic
904474855 1:30758104-30758126 CTGTTTCCTCATCTGGAAATGGG - Intergenic
907548769 1:55286484-55286506 CTGTCCAGTCTCCTTGAGATAGG - Intergenic
908080821 1:60576396-60576418 CTGTTTCCTCACCTTCAAAATGG + Intergenic
908142222 1:61198048-61198070 CTGTTTACTCTACTTGAAGTGGG - Intronic
909071209 1:70995956-70995978 CTGTTTACTCATCTATAAATTGG - Intronic
910053038 1:82998733-82998755 CTGTCTCCTCACTGTTAAATTGG + Intergenic
910065381 1:83144471-83144493 CTGTCTTCTCTCCTTGAAATTGG + Intergenic
910191334 1:84598931-84598953 CTGCCAACTCAATTTGAAATTGG - Intergenic
910250782 1:85196707-85196729 ATTGCTACTCACCTTGAAAAGGG + Intronic
910456435 1:87402523-87402545 TAGTCTACGCACATTGAAATGGG - Intergenic
911530680 1:99039692-99039714 CTGTTCACTCACCTGGAAAGCGG + Intergenic
912738274 1:112169458-112169480 CTGTCAGCTCACCTTTAGATAGG + Intergenic
913021473 1:114792325-114792347 CTGTTCACTCACCTGGAAAGAGG - Intergenic
913289003 1:117254896-117254918 CTGTCTCCTCATCTTTAAATTGG + Intergenic
914855953 1:151350810-151350832 CTGTCTCCTCACCTGTAAAATGG - Intergenic
915167260 1:153955053-153955075 GGGTCTACTCACCTGGAACTCGG + Exonic
915224521 1:154402724-154402746 CAGTCTACTCATCTGAAAATTGG + Intergenic
915596311 1:156898272-156898294 CTGTTTACTCATCAGGAAATGGG - Intronic
916483737 1:165238084-165238106 CTGTCTATCCACCTTTACATTGG - Intronic
916806924 1:168268653-168268675 CTGTATGCTCACCTGGAAAGCGG + Intergenic
917194530 1:172451267-172451289 CTCTCTACTCACTTTGATCTGGG + Intronic
918846827 1:189626365-189626387 CTGTTTACTCACCTCTAAAATGG - Intergenic
919021836 1:192115736-192115758 CTGTTTCCTCACCTAAAAATTGG - Intergenic
919410020 1:197231402-197231424 ATGTCTACTCACCTGGCAACAGG - Intergenic
922435173 1:225598034-225598056 CTGTCTCCTTACCTTAAAAAAGG - Intronic
922875814 1:228939147-228939169 CTGTCTTCTCACCTGTAAAATGG - Intergenic
924054357 1:240111173-240111195 CTGTTTCCTCATCTAGAAATTGG - Intronic
924182124 1:241449321-241449343 CTGTCTACTCTCCTCCAATTAGG - Intergenic
924829035 1:247573159-247573181 CTGTTTACTCCCCTGGAAAAGGG - Intronic
924878196 1:248128742-248128764 CTGTCCACTCCCCTGGAAAGGGG + Intergenic
924894075 1:248316969-248316991 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
1065313556 10:24439845-24439867 CAGTCAGCTGACCTTGAAATAGG - Intronic
1068313239 10:55306811-55306833 CTGTATACTCATCTTTGAATGGG - Intronic
1068406223 10:56593023-56593045 CTGTTTACTCTGCTTGAAAAAGG + Intergenic
1069987785 10:72296066-72296088 CTTTCTACTCAACTGGAACTTGG + Intergenic
1070828768 10:79406156-79406178 CTATTTCCTCACCTGGAAATGGG - Intronic
1072271661 10:93783033-93783055 ATGTCTAGTTACCTTGAAACTGG - Intronic
1073819602 10:107245837-107245859 CTGTCTCCACTCCTTGAAACAGG + Intergenic
1073921365 10:108463460-108463482 CTGCCTACTAACCAGGAAATGGG + Intergenic
1074463517 10:113661202-113661224 CTGTTTCCTCACCGTAAAATGGG + Intronic
1075051555 10:119186120-119186142 CAGTCTCCTCACCTTGGAAATGG - Intergenic
1075635947 10:124030318-124030340 CTGTTGACACACCTTGATATGGG - Intronic
1076620499 10:131784418-131784440 CTGTCTAATCGCCTTGAGAGGGG - Intergenic
1079155778 11:17946703-17946725 CTGTGTTCTCACCCTAAAATAGG + Intronic
1079323612 11:19472973-19472995 CTGTCTTCTCATCTGGAAAATGG - Intronic
1080717830 11:34821100-34821122 CTGTTTTCTCACCTTGAAAATGG - Intergenic
1080767124 11:35307309-35307331 CTGTCTTCCCACCTTGAATTTGG - Intronic
1081211390 11:40338989-40339011 CTGGTTACTCATCTTGAAACAGG - Intronic
1084185040 11:67467153-67467175 CTGTCTCCTCACCTGTAAAATGG + Intronic
1084906710 11:72354064-72354086 CTTTCTCCTCATCTGGAAATGGG - Intronic
1084955854 11:72691183-72691205 CTGTTTTCTCACCTGGAAGTGGG + Intronic
1087487413 11:98773161-98773183 CTGTAAACTAACCTTGAAAATGG + Intergenic
1088298990 11:108335078-108335100 CTGTCTCCTCTCCTTGCCATCGG - Exonic
1088300634 11:108354468-108354490 CTGTGTACTCAACTTGGATTGGG + Intronic
1089178828 11:116566981-116567003 CAGTCTACTCAACCTGAAATAGG + Intergenic
1090444692 11:126753770-126753792 CTGTCTCCTTACCTAGAAAATGG + Intronic
1090991558 11:131821539-131821561 CTGTCTCCTCATCTTTAAAATGG + Intronic
1091371193 11:135059698-135059720 CTGTCTACTTGCCCTGAGATGGG - Intergenic
1091562432 12:1625320-1625342 GTGAGTACTCACCTGGAAATTGG + Intronic
1091902179 12:4153287-4153309 CTTTCTACTCATCTGGAAACTGG + Intergenic
1092973152 12:13718296-13718318 TTGTCTCCTCACCTTGAAGGAGG - Intronic
1093175582 12:15910300-15910322 CTGTCTACTTACCTGTAAAGTGG - Intergenic
1093498646 12:19784531-19784553 CTGTCTTCTCTCCATGAAAGAGG + Intergenic
1096818979 12:54219248-54219270 CTGTTTCCTCACCTTAAAATGGG + Intergenic
1096846682 12:54411256-54411278 CTGTCTCCTCACTTAGAAAATGG + Intronic
1099019576 12:77386715-77386737 CAGACTACTGACCTGGAAATAGG + Intergenic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1100309423 12:93380027-93380049 CTGTCTCCTCACCTATAAAATGG - Intronic
1101647072 12:106641323-106641345 CAGTCTACTCACCTGTAAAATGG + Intronic
1101775513 12:107789629-107789651 ATGTCTACTCATCTAGAAAGAGG + Intergenic
1101921272 12:108935088-108935110 CTGTCTACCCAACTGGCAATAGG + Intronic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1102186741 12:110954217-110954239 CTGTCCCCTCTCCTTGAATTGGG - Intergenic
1102550824 12:113690909-113690931 CAGTTTCCTCACCTTGAAAATGG + Intergenic
1103170692 12:118816923-118816945 CTGTCTGCTCCCCTTGAATCTGG + Intergenic
1103883420 12:124183822-124183844 CTGTTTCCTCATCTTGAAAATGG - Intronic
1104410862 12:128556590-128556612 TTGTCTTCTCCCCTTGAAACTGG + Intronic
1106187665 13:27423554-27423576 CAGTCTGCTCATCTTGAAAGTGG - Intergenic
1106190821 13:27450937-27450959 CTGTCTGCTCACCTGCAAATCGG - Intergenic
1107749626 13:43550659-43550681 CTGTTTTCTCACCTATAAATTGG - Intronic
1108721309 13:53135691-53135713 ATGTCTTCTCCCCTTGAATTTGG + Intergenic
1108932065 13:55837502-55837524 CTGTTTCCTCATCTGGAAATGGG + Intergenic
1110678130 13:78275364-78275386 CAGTTTACTCACCTAGAGATTGG - Intergenic
1114575568 14:23709724-23709746 CTGTCTAGTAGCCTTGAAAAAGG + Intergenic
1114965912 14:27958999-27959021 CTGCCTAATCACCTTCAATTTGG - Intergenic
1115182108 14:30641043-30641065 CTGTTTTCTCATCTTGAAAATGG - Intronic
1115273155 14:31577077-31577099 CTGTCTCCTCCCCTTGAATGTGG - Intronic
1117760407 14:59021232-59021254 GTTTCTCCTCCCCTTGAAATTGG - Intergenic
1121226744 14:92326850-92326872 CTGTTTTCTCACCTGTAAATGGG + Intronic
1121988447 14:98530633-98530655 CTGTCTACTCACTGTGAGCTGGG - Intergenic
1122087449 14:99317614-99317636 CTGTCTTTGCACCTTAAAATGGG - Intergenic
1126582233 15:50252418-50252440 CTGGCCACTCACCATGAAGTCGG + Exonic
1126943679 15:53793406-53793428 CAGTGTACTCCCCTTCAAATTGG - Intergenic
1127029999 15:54851186-54851208 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
1127660904 15:61099212-61099234 CTGTTTACTCAGATTGGAATGGG + Intronic
1127766449 15:62189963-62189985 TTGTCTATTCACCATGAATTGGG + Intergenic
1128688406 15:69704715-69704737 CTGTCTGCACACCTTGATCTTGG - Intergenic
1131478413 15:92761486-92761508 CTGGCTTTTCACCATGAAATTGG + Intronic
1131697216 15:94890809-94890831 CAGTTTCCTCACCTTGAAAGTGG + Intergenic
1132062691 15:98705472-98705494 CTGTTTCCTCACCTTTAAAATGG + Intronic
1132434433 15:101785848-101785870 CTCTGTACTCACCTAGAACTTGG - Intergenic
1134836488 16:17365490-17365512 ATGTGAACTCACCTTCAAATAGG + Intronic
1134892252 16:17851472-17851494 CTGTTTACCCACCTGGAAATGGG + Intergenic
1135802450 16:25510549-25510571 CAGTTAACTCAACTTGAAATAGG + Intergenic
1135877742 16:26219029-26219051 CTGGCTATTCACCTGGGAATAGG - Intergenic
1138467454 16:57201994-57202016 CAGTTTACTCATTTTGAAATAGG + Intronic
1139872983 16:70122588-70122610 CTGTTTTCTCCCCTTGTAATGGG + Intronic
1141350418 16:83289733-83289755 CAGTTTTCTCACTTTGAAATGGG + Intronic
1141677264 16:85524367-85524389 CTGTCTACTTATCTAGTAATGGG + Intergenic
1143143030 17:4753479-4753501 CTGTCTCCTCACCTGTAAAATGG + Intergenic
1148826642 17:50398771-50398793 CAGTTTACTCATTTTGAAATAGG + Intergenic
1149111967 17:53045350-53045372 CTATCTACTGACCTTGAGAAGGG + Intergenic
1150644755 17:66971083-66971105 CTGTCTCCTCATCTGAAAATGGG + Intronic
1151431003 17:74063169-74063191 CAGTTTTCTCACCTGGAAATGGG + Intergenic
1151925693 17:77194641-77194663 ATATATACTCACCTTTAAATTGG + Intronic
1154101570 18:11479420-11479442 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1155318619 18:24596522-24596544 CTGTCTACCAACTTTGAAACAGG - Intergenic
1156832725 18:41514166-41514188 TTGTCTCCTCACCTTCAAAATGG + Intergenic
1157410343 18:47457944-47457966 CAGTTTACTCATCTGGAAATCGG + Intergenic
1159384520 18:67706550-67706572 CTTTCTCCGCACCTTCAAATAGG - Intergenic
1162312689 19:9916480-9916502 CAGTTTCCTCACCTGGAAATAGG - Intronic
1164923235 19:32105315-32105337 CAGTTTACTCATCTTAAAATGGG + Intergenic
1165854098 19:38869740-38869762 GTGTCTACGCGCCTTGAGATGGG - Intronic
1167116321 19:47491223-47491245 CTGTTTCCTCACTTTGAAAAGGG - Intronic
1168033876 19:53703469-53703491 ATGTCAACTCTCTTTGAAATGGG - Intergenic
925877925 2:8328222-8328244 CTGTCTCCTCACCTGTAAAATGG + Intergenic
926458801 2:13101971-13101993 CTGTCTACTCATGTTGAATGAGG - Intergenic
926639699 2:15221143-15221165 CTGTCTATTCAGCTTGCAAAAGG - Intronic
931546704 2:63396171-63396193 ATGCCTACTCATCTTAAAATTGG - Intronic
933780911 2:85800428-85800450 CTGTCCACACAACTAGAAATTGG - Intergenic
937289594 2:120774050-120774072 CCTGCTCCTCACCTTGAAATTGG - Intronic
937619191 2:123966124-123966146 CCTTCTACTCACCTTGCCATTGG + Intergenic
937782905 2:125859696-125859718 CTGTTTCCTCACCTTTAAAATGG - Intergenic
944191189 2:197006039-197006061 CTGCCTTCTGCCCTTGAAATAGG - Intronic
945210914 2:207381175-207381197 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
947959861 2:234227419-234227441 ATCTCTTCTCACCTTGAACTAGG - Intergenic
948046414 2:234949113-234949135 CAGTGTTCTCACCTTGAAGTGGG - Intergenic
1168839056 20:897358-897380 CCGTTTACTCAATTTGAAATTGG - Intronic
1169231622 20:3893142-3893164 CTGTTTTCTCATCTGGAAATTGG - Intronic
1170737899 20:19026881-19026903 GTGTCTCCTCACCTTGAATCTGG - Intergenic
1172871424 20:38137886-38137908 CAGTCTACTCATCTGGAAAACGG + Intronic
1173540980 20:43850840-43850862 CTGTCTCCTCAATTAGAAATTGG + Intergenic
1173544180 20:43880154-43880176 CTCTCTTCTCACCTTTGAATAGG + Intergenic
1173551845 20:43937993-43938015 CCGTTTTCTCACCTGGAAATAGG + Intronic
1173840207 20:46152069-46152091 CTGTTTCCTCACCTGGAGATGGG + Intergenic
1174300201 20:49576165-49576187 CTGGCTTCTCATCTTGAAAATGG + Intergenic
1174412125 20:50343155-50343177 CAGTCTTCTCACCTTGAAAGTGG - Intergenic
1174626677 20:51920700-51920722 CTGTCTCCTCACCTTTAAAATGG - Intergenic
1174902749 20:54517851-54517873 CTGTCTATGGACCATGAAATGGG + Intronic
1177213612 21:18100934-18100956 CTGTCTACTCAGCAGTAAATTGG + Intronic
1178922647 21:36748347-36748369 TGGTTTCCTCACCTTGAAATCGG + Exonic
1179711981 21:43268777-43268799 CTGGCAACTCAGCTGGAAATGGG - Intergenic
1181470805 22:23138250-23138272 CTTTCTTCCCACCTTGAAAGTGG + Intronic
1181604500 22:23972137-23972159 CTGTCTTCTCATCATAAAATTGG + Exonic
1183420955 22:37710885-37710907 CTGTACACTCACCTTGCAGTGGG + Intronic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
951916001 3:27801454-27801476 CAGTTTCCTCACCTTCAAATGGG - Intergenic
954658182 3:52210476-52210498 CTGGCTACTCACTTTTAAAAGGG - Intronic
955481249 3:59392660-59392682 ATTTCTCCTCTCCTTGAAATTGG - Intergenic
956039180 3:65128359-65128381 TTCTCTACTCCCCTTGAGATGGG + Intergenic
956305883 3:67825110-67825132 CTGTCCACTGACATTGCAATGGG + Intergenic
959467169 3:106702197-106702219 CTATCTACTCATGTTGAGATTGG + Intergenic
960298288 3:115970217-115970239 CTCTTTCCTCACCTTGGAATAGG + Intronic
962476665 3:135760994-135761016 CTGGCTTCTCACCTCTAAATTGG + Intergenic
963401762 3:144806991-144807013 CAGTCCACTCACCTGGAAAGGGG - Intergenic
966164163 3:176998339-176998361 TTGTCAACTGACCTTGAAATAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966909670 3:184551979-184552001 CTGTCTCCTCACCTGGAAAATGG - Intronic
968530955 4:1091338-1091360 CTGTCTAGACAGCTTGAACTGGG + Intronic
969362143 4:6671758-6671780 CTGTTTCCTCAGCTTGAAATGGG - Intergenic
969513028 4:7630462-7630484 CCCTCTCCTCACCTTCAAATTGG - Intronic
969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG + Intronic
970185392 4:13446356-13446378 CTGTCCACTCCCCTGGAAAGGGG - Intronic
970722912 4:19008897-19008919 CTTTCATCTCACCTTTAAATTGG + Intergenic
971029029 4:22616997-22617019 CTGTCTCCTCACCTTGCAGATGG + Intergenic
971755659 4:30704686-30704708 CTGTCCCCTCCCCTTGAAACAGG - Intergenic
971923775 4:32979319-32979341 CTGTTTTCTCACTTTGAAGTGGG + Intergenic
972979760 4:44682071-44682093 CAGTCTACTAAGCTTGAGATAGG - Intronic
974580105 4:63787355-63787377 TTGTCTACTCAATTTAAAATTGG - Intergenic
975038536 4:69713994-69714016 CAGTATTCTCACCTTTAAATAGG + Intergenic
977588158 4:98798202-98798224 CTGTTTTCTCACCTTTAAAGTGG - Intergenic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
978744475 4:112176067-112176089 CTGTTTACTCACTTTGGAAAGGG - Intronic
979417433 4:120460808-120460830 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
980774777 4:137423471-137423493 ATGTCTACTCACATTGAAAAAGG + Intergenic
980855206 4:138431575-138431597 CTATCTACTCCCCTGGAAAGGGG + Intergenic
981221147 4:142236645-142236667 CTGTCTAATTTCCCTGAAATTGG + Intronic
983256690 4:165407981-165408003 CTGTCTATTCATTTTAAAATGGG + Intronic
983647903 4:170010528-170010550 CAGTCTACTCAACTTGAAGATGG + Intronic
984416847 4:179471670-179471692 TGGTCTCCTCACCTTGAAACTGG + Intergenic
986596310 5:9425949-9425971 CTGTTCACTCACCTTTAAATGGG + Intronic
987656512 5:20814783-20814805 CTGTTTATTCGCCTGGAAATGGG + Intergenic
987989574 5:25193141-25193163 CTGTCCACCCACATTGAAGTTGG - Intergenic
988157757 5:27476913-27476935 ATGGCTACTCATCTAGAAATAGG - Intergenic
991022904 5:61999231-61999253 CAGACTTCTCACCTTAAAATGGG + Intergenic
991726885 5:69544669-69544691 ATGGCTACTCCCCTTTAAATTGG + Intronic
991868072 5:71083205-71083227 ATGGCTACTCCCCTTTAAATTGG - Intergenic
994005184 5:94828929-94828951 CTGTTTACTCCCCTGGAAAGGGG - Intronic
994312425 5:98289983-98290005 CAGTCTACTTTCCTTTAAATAGG + Intergenic
994406721 5:99353850-99353872 CTTTCTTCTCACTTTGAATTTGG + Intergenic
995538599 5:113162366-113162388 CAGTCTACTCATCTTTAAAATGG + Intronic
995703159 5:114958138-114958160 AAGCCTTCTCACCTTGAAATTGG - Intergenic
996242489 5:121221069-121221091 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
996261998 5:121483074-121483096 CTGTTTTCTCACCATTAAATTGG - Intergenic
996818599 5:127600280-127600302 CTGTCTCTTCCCCTTGAAACTGG - Intergenic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
997715428 5:136039261-136039283 CTGTCTCCTCATCTGTAAATGGG - Intronic
998128628 5:139640055-139640077 CTATCTAGTCAGCTTGAGATAGG + Intergenic
998185168 5:139973780-139973802 CTGTCTACGAACCAGGAAATGGG - Intronic
999030096 5:148281272-148281294 CTGTTCACTCACCTGGAAAGGGG - Intronic
999869713 5:155736631-155736653 CTATCTTCTCACCTTTTAATGGG + Intergenic
1000346081 5:160314566-160314588 TTGTCTACTCACCTTGCCTTTGG - Intronic
1001244853 5:170098463-170098485 CTGTGTCCTCACCTATAAATTGG - Intergenic
1001659591 5:173381039-173381061 TTGTCAACTCACTTTGAAGTTGG + Intergenic
1002902573 6:1422576-1422598 CTGTTTTCTCACCTAGAAAATGG + Intergenic
1003141114 6:3472100-3472122 CTGTTTCCTCTCCTAGAAATGGG - Intergenic
1003734713 6:8865712-8865734 TTCTCTACTCAACTGGAAATGGG - Intergenic
1004817346 6:19326369-19326391 CTGTCTTTTCTCCTTCAAATGGG - Intergenic
1005376314 6:25186022-25186044 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1005966361 6:30729492-30729514 CTGTTTCCTCATCTTAAAATTGG - Intronic
1007968511 6:46026793-46026815 GTGTCTACTTAGCTGGAAATGGG - Intronic
1008196277 6:48525258-48525280 CTTTCTACTGTCTTTGAAATTGG - Intergenic
1008690226 6:53970816-53970838 CTGTCTAGTCATTTTTAAATGGG + Intronic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1011206144 6:84900978-84901000 CTGTCTACTTACAATGACATAGG - Intergenic
1012343500 6:98157141-98157163 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1016722957 6:147323806-147323828 CTGTCTTTTCACCTAGAAAGTGG - Intronic
1019827778 7:3299001-3299023 CTGTCTACTACCCTGGAGATGGG + Intergenic
1022297934 7:29074075-29074097 CAGTGTCCTCATCTTGAAATGGG - Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1022575762 7:31495518-31495540 CTGTTTCCTCACCTTCAAAGTGG - Intergenic
1024659723 7:51481943-51481965 CAGTCTACTCACCTACAAAATGG - Intergenic
1025246487 7:57321393-57321415 CTGGCTAGTCACCTTTAATTAGG - Intergenic
1026150297 7:67782691-67782713 CTGTCAAATTACCTGGAAATGGG - Intergenic
1027278726 7:76590277-76590299 CTGTCTTCTCTCCTTGAAATTGG - Intergenic
1028018160 7:85740529-85740551 CTTTCTACTCTCCTTGATAAAGG + Intergenic
1028148882 7:87349462-87349484 CTGTCTGCTCACCCTCACATAGG - Intronic
1028720717 7:94027794-94027816 CAATCAACTCACCTTAAAATAGG + Intergenic
1028802353 7:94980946-94980968 CTGTTTGTTCACCTTCAAATAGG - Intronic
1032447836 7:131999935-131999957 CTGGCTCCTCACCTTGGAAATGG - Intergenic
1033987703 7:147246480-147246502 CTCTCTACTAACCAAGAAATGGG - Intronic
1034954325 7:155325015-155325037 CTGTTTTCTCATCTTAAAATGGG - Intergenic
1035664602 8:1371806-1371828 CTGTCCACTCACCCTGGAAGTGG + Intergenic
1035862126 8:3040111-3040133 CTGACTTCTCACTCTGAAATTGG - Intronic
1035917843 8:3644414-3644436 CAGTTTCCTCACCTTAAAATAGG + Intronic
1036424437 8:8630578-8630600 CTGTGTCCTCACCTTGCAAAAGG - Intergenic
1036501708 8:9320089-9320111 CTGTTTCCTCACCTTTAAAATGG + Intergenic
1039215609 8:35266895-35266917 CTGTCTACTTGTCTTGGAATAGG - Intronic
1040868538 8:52076243-52076265 TTGTCTTCTCACATAGAAATGGG - Intergenic
1042077989 8:65016831-65016853 CTGTCTCCTCAACTTGACTTGGG + Intergenic
1046588158 8:116173536-116173558 CTCTCTAATCTACTTGAAATGGG - Intergenic
1047511113 8:125516409-125516431 ATGTCCACTGACCTTGAATTTGG - Intergenic
1047923967 8:129664603-129664625 CTGTCTTTTCATCTTGAAAAAGG - Intergenic
1048630126 8:136233652-136233674 CTGTCCACTCTCCTGGAAAGGGG - Intergenic
1052012202 9:23423663-23423685 CAGTCTCCTCACCTGTAAATTGG - Intergenic
1053416191 9:37948253-37948275 CTGTTTACTCATCTGCAAATTGG + Intronic
1053594788 9:39548831-39548853 TTGTTAACTCACTTTGAAATAGG + Intergenic
1053852572 9:42303864-42303886 TTGTTAACTCACTTTGAAATAGG + Intergenic
1054571466 9:66816136-66816158 TTGTTAACTCACTTTGAAATAGG - Intergenic
1054957923 9:70934565-70934587 CGGTTTCCTCACCATGAAATGGG + Intronic
1055352502 9:75403727-75403749 CTGTGTCCTCACCTTCAAAATGG - Intergenic
1055729948 9:79270235-79270257 CTGTTTACTCATCTTTAAAATGG - Intergenic
1058218464 9:102264327-102264349 CTTTCTACTCAGCTTGTAGTAGG + Intergenic
1060211636 9:121713975-121713997 CTGTCTCCTCATTTTTAAATGGG + Intronic
1061469096 9:130808552-130808574 CTGCCCACCCATCTTGAAATTGG - Intronic
1061505673 9:131030590-131030612 CAGTCTCCTCATCTTTAAATGGG + Intronic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1189429282 X:40932733-40932755 CTGTCCACTGGCCTTGAAATTGG + Intergenic
1189712249 X:43825479-43825501 CTGACTACCCTACTTGAAATTGG + Intronic
1190524874 X:51318771-51318793 CTGTGTATTCACTTTGAAAAAGG - Intergenic
1191972942 X:66838059-66838081 CTGTCCACTCCCCTTGAAAGGGG + Intergenic
1192701807 X:73482313-73482335 CTGTCCACTCCCCTGGAAAGGGG - Intergenic
1193081607 X:77412028-77412050 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1195743811 X:108093454-108093476 CTGTCTACTCACTATTAGATAGG + Intronic
1196061109 X:111409284-111409306 CTGTGTACCCACCTCAAAATAGG - Intronic
1197718660 X:129729018-129729040 TTGTCCACTCCCCTTGAAACTGG - Intergenic
1198050078 X:132943382-132943404 CTGTTTTCTCATCTTTAAATGGG + Intronic
1198645520 X:138802069-138802091 CTGTTTACTCCCCTGGAAAGGGG - Intronic
1199801191 X:151252869-151252891 CTGTCCACTCTCCTGGAAAGGGG + Intergenic
1200298553 X:154948077-154948099 CTGTCTCCTCACATTGGGATTGG - Intronic