ID: 969648375

View in Genome Browser
Species Human (GRCh38)
Location 4:8447607-8447629
Sequence TTCCTGAGCCTCTGAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1229
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 1161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969648372_969648375 -3 Left 969648372 4:8447587-8447609 CCTTGAAATGGGTTTAATCATTC 0: 1
1: 1
2: 2
3: 31
4: 425
Right 969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG 0: 1
1: 0
2: 5
3: 62
4: 1161
969648369_969648375 11 Left 969648369 4:8447573-8447595 CCTCTGTCTACTCACCTTGAAAT 0: 1
1: 0
2: 1
3: 16
4: 276
Right 969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG 0: 1
1: 0
2: 5
3: 62
4: 1161
969648368_969648375 12 Left 969648368 4:8447572-8447594 CCCTCTGTCTACTCACCTTGAAA 0: 1
1: 1
2: 2
3: 27
4: 254
Right 969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG 0: 1
1: 0
2: 5
3: 62
4: 1161
969648366_969648375 20 Left 969648366 4:8447564-8447586 CCTCCTGGCCCTCTGTCTACTCA 0: 1
1: 0
2: 3
3: 29
4: 423
Right 969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG 0: 1
1: 0
2: 5
3: 62
4: 1161
969648367_969648375 17 Left 969648367 4:8447567-8447589 CCTGGCCCTCTGTCTACTCACCT 0: 1
1: 0
2: 6
3: 41
4: 446
Right 969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG 0: 1
1: 0
2: 5
3: 62
4: 1161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969648375 Original CRISPR TTCCTGAGCCTCTGAGGAGG TGG Intronic
900146202 1:1159911-1159933 TTGCTGAGCCTGGGAGGTGGAGG - Intergenic
900222500 1:1516824-1516846 TTCCTCAGCCTCCGAGCAGCTGG + Intronic
900650778 1:3729188-3729210 ATCCTGAGCCTCTGGGGTGCTGG + Intronic
900951711 1:5861753-5861775 TTCCTGAGCCTCTGAGAGGGTGG + Intergenic
901058320 1:6459979-6460001 TTCCTGAGGCAGTGGGGAGGGGG - Exonic
901273177 1:7969692-7969714 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
901277724 1:8005750-8005772 TGCCTCAGCCTCCGAGTAGGTGG + Intronic
901342404 1:8507156-8507178 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
901522289 1:9794390-9794412 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
901539718 1:9908140-9908162 TTCCTGAACCTGGGAGGCGGAGG - Intronic
901580491 1:10238619-10238641 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
901732323 1:11289158-11289180 TTCCTGAGAGACTGAGCAGGCGG + Intronic
902027758 1:13396455-13396477 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
902028237 1:13400577-13400599 TGCCTCAGCCTCTGGGGAGCTGG - Intergenic
902040974 1:13492120-13492142 TGCCTGTGCCTGGGAGGAGGGGG - Intronic
902136367 1:14309642-14309664 TACCTGAGCCTGGGAGGTGGAGG - Intergenic
902579628 1:17400122-17400144 TTCTTGAGCCCCGGAGGTGGAGG + Intronic
902906089 1:19558468-19558490 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
902922146 1:19672401-19672423 TTCCTCCTCCTCAGAGGAGGAGG + Intronic
903818496 1:26082829-26082851 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
903851493 1:26309352-26309374 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
904038570 1:27571572-27571594 TTCCTGAGCCTGAGGGGAGCAGG - Intronic
904204240 1:28842447-28842469 TTCCTGGGCCTCTGGAGAGCTGG - Intronic
904239573 1:29135052-29135074 TTTCTGAGCCTCCCAGGAAGGGG - Intergenic
905018033 1:34791020-34791042 TTCTTCATCCTCTGGGGAGGAGG + Intronic
905038438 1:34931726-34931748 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
905039696 1:34945781-34945803 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
905093535 1:35449234-35449256 TTCCTGAGCTTCTGATGAAATGG - Intronic
905467422 1:38165945-38165967 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
905664648 1:39755688-39755710 TCCCTGATACTCTGGGGAGGTGG + Intronic
906188943 1:43883278-43883300 TTCCTGAGCCACTTAGGAAGGGG + Intronic
906454932 1:45986601-45986623 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
907035667 1:51213795-51213817 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
907209820 1:52810918-52810940 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
907301402 1:53488805-53488827 TTCATGAGCCTGGGAGGTGGAGG + Intergenic
907369728 1:53992978-53993000 TTTCTGAGCCTGTGAGGACAGGG + Intergenic
908192861 1:61721145-61721167 CTCCTGAGCCTGGGAGGTGGAGG + Intronic
908230624 1:62101375-62101397 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
908581189 1:65519231-65519253 TTCTTGAGCCTGGGAGGTGGAGG - Intronic
908763182 1:67531108-67531130 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
908840872 1:68278851-68278873 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
909614618 1:77592414-77592436 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
909647222 1:77931297-77931319 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
909728250 1:78862249-78862271 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
909879916 1:80861863-80861885 TTCCTGAACCTGGGAGGCGGAGG + Intergenic
910029655 1:82703237-82703259 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
910325104 1:85997666-85997688 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
911215673 1:95190441-95190463 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
911593305 1:99772213-99772235 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
911613349 1:99981561-99981583 TTCTTGAACCTGGGAGGAGGAGG - Intronic
911617031 1:100024730-100024752 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
911669896 1:100595836-100595858 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
912125358 1:106530827-106530849 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
912355538 1:109052284-109052306 TGCTTGAGCCTCGGAGGTGGAGG - Intergenic
912357358 1:109065805-109065827 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
912431776 1:109631805-109631827 TTCCTGTGCCTCTGTGGGAGAGG + Exonic
912574394 1:110652141-110652163 TTCCTCAGCCTCCGAGTAGCTGG - Intergenic
912621592 1:111165161-111165183 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
912820680 1:112865364-112865386 TGCTTGAGCCTGTGAGGTGGAGG - Intergenic
912854603 1:113156056-113156078 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
912890099 1:113521198-113521220 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
912930124 1:113950615-113950637 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
912995134 1:114525602-114525624 CACCTCAGCCTCTGAGGAGCTGG + Intergenic
913003516 1:114605708-114605730 TTCTTGAGCCTGGGAGGACGAGG + Intronic
913215583 1:116617349-116617371 TGCCTGAGCCACTCAGAAGGCGG + Intronic
913280968 1:117184753-117184775 GTCCTTAGCCTCTGAGTAGCAGG - Intronic
914241359 1:145855125-145855147 TCACTGAGTCCCTGAGGAGGAGG + Intronic
914760587 1:150595283-150595305 CACCTCAGCCTCTGAGGAGCTGG - Intergenic
914761303 1:150600781-150600803 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
914762458 1:150610203-150610225 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
914867835 1:151447533-151447555 TTCTTGAGCCTGGGAGGTGGAGG - Intronic
915047661 1:153032180-153032202 TTTCTGAGCCTTTGAAGAAGAGG - Intronic
915187847 1:154122539-154122561 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
915455966 1:156040979-156041001 TCTCTGAGACTCTGGGGAGGGGG - Intronic
915514450 1:156404742-156404764 TACCTCAGCCTCTGAGTAGCTGG + Intronic
915896818 1:159818176-159818198 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
916361257 1:163971887-163971909 TTCATGGGGCTCTGTGGAGGTGG + Intergenic
916707114 1:167362624-167362646 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
916815295 1:168345844-168345866 TTCTTGAGGCTCTGAGCAGCTGG + Intergenic
917082813 1:171273589-171273611 TTCTTGAGCCTAGGAGGTGGAGG - Intronic
917415430 1:174804352-174804374 TGCCTGAGCCTGGGAGGCGGAGG - Intronic
917523975 1:175770941-175770963 TTACTGAGGCTCTGAGGCTGTGG + Intergenic
917745341 1:178001183-178001205 TCCCTGGTCCTCTAAGGAGGTGG - Intergenic
917942362 1:179935070-179935092 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
918220294 1:182430530-182430552 CTCCTGTGCATCAGAGGAGGTGG + Intergenic
919193453 1:194253146-194253168 CCCCTGAGCCTCAGAGGAAGAGG + Intergenic
919596830 1:199574631-199574653 TACCTGAGCCTGGGAGGTGGAGG + Intergenic
919659560 1:200230494-200230516 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
919803992 1:201369837-201369859 TCCCTGAACCTCAGAAGAGGAGG - Intronic
919903320 1:202059937-202059959 TGCCTGAGCCTGGGAGGTGGAGG - Intergenic
920041346 1:203099744-203099766 TTCCAGAGGCCCTGAGCAGGTGG - Intronic
920191444 1:204196568-204196590 TTCAGGAGGGTCTGAGGAGGAGG - Intergenic
920211053 1:204328499-204328521 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
920689425 1:208134636-208134658 TGGCTGAGCCTCTGGGGAGGAGG - Intronic
921112938 1:212056104-212056126 TTCTTGAGCCCCTGGGCAGGAGG - Intronic
921664319 1:217849726-217849748 TTCCTGAACCTGAGGGGAGGAGG + Intronic
921971449 1:221153598-221153620 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
922052619 1:222008615-222008637 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
922237053 1:223729886-223729908 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
922275152 1:224070737-224070759 TTCCTGAGCCTTTTAGGACTTGG - Intergenic
922474060 1:225894491-225894513 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
922596067 1:226814160-226814182 TGCTTGAGCCTAGGAGGAGGAGG + Intergenic
922615402 1:226958331-226958353 GTACTGAGCTACTGAGGAGGGGG + Intronic
922691342 1:227694189-227694211 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
922799073 1:228355997-228356019 TTCCTGGGCCTCTGACATGGAGG - Intronic
922931806 1:229395964-229395986 CACCTCAGCCTCTGAGAAGGTGG - Intergenic
923637968 1:235720059-235720081 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
923991810 1:239446049-239446071 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
924216731 1:241830153-241830175 TGCCTTAGCCTCTGAGTAGCTGG - Intergenic
924223799 1:241904274-241904296 TGCCTCAGCCTCTGAGTAGATGG - Intergenic
924411954 1:243815679-243815701 TTCTTGAGCCTGGGAGGTGGGGG - Intronic
924697391 1:246414829-246414851 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
924739823 1:246788537-246788559 TGCCTGAACCTGGGAGGAGGAGG - Intergenic
1062888056 10:1034359-1034381 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1062999106 10:1897696-1897718 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1063148465 10:3317581-3317603 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1063280258 10:4620720-4620742 TGCCTGTGCATCTGAGGAGATGG - Intergenic
1063356182 10:5400515-5400537 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1063392237 10:5658042-5658064 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1064092274 10:12395312-12395334 TTCCCAAACCTCTGCGGAGGCGG - Intronic
1064126220 10:12663073-12663095 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1064456249 10:15490258-15490280 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1065046574 10:21751866-21751888 TTCCTGACCCTCTGTGGGCGGGG + Intergenic
1065253266 10:23838542-23838564 TGCTTGAGCCTCGGAGGCGGAGG - Intronic
1065323824 10:24533173-24533195 CTCCTCATCCTTTGAGGAGGAGG - Exonic
1065352206 10:24805755-24805777 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1065451492 10:25863257-25863279 TGCCTCAGCCTTTGAGTAGGTGG - Intergenic
1065603948 10:27396399-27396421 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1066179584 10:32946956-32946978 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1066194206 10:33083125-33083147 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1066359688 10:34718068-34718090 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1066392759 10:34991411-34991433 TGCCTGAACCTCTGAGTAGCTGG - Intergenic
1067223907 10:44363230-44363252 TTCCTGAGCCTTGGGGGAGGCGG - Intergenic
1067250895 10:44586524-44586546 CTCCTGGGCCTCAGAGGAGCTGG - Intergenic
1068014573 10:51499843-51499865 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1068087716 10:52395521-52395543 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1068412976 10:56681787-56681809 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1068443003 10:57083945-57083967 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1069122144 10:64580200-64580222 TTCTTGAGCCTGAGAGGTGGAGG - Intergenic
1069538782 10:69277451-69277473 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1069566906 10:69469559-69469581 TTCTTGAGCCTGGGAGGTGGAGG - Intronic
1069690352 10:70347733-70347755 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1069707193 10:70466357-70466379 TTTCTCAGCCTCTGAGTAGTTGG + Intergenic
1069913187 10:71772175-71772197 GGCCTGGGCCTCTGAGGAGGAGG - Intronic
1070005791 10:72422822-72422844 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070128963 10:73643578-73643600 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
1070175716 10:73967509-73967531 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1070177456 10:73984292-73984314 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1070195823 10:74155641-74155663 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070196632 10:74163079-74163101 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1070265305 10:74896403-74896425 TGCCTTAGCCTCTGAGTAGCCGG + Intronic
1070294142 10:75144769-75144791 TGCCTGAGCCTCTGAGTAGCTGG + Intronic
1070311727 10:75278578-75278600 TACATGAGCCTCGGAGGCGGAGG + Intergenic
1071347715 10:84708392-84708414 TGCCTGAACCTGTGAGGCGGAGG - Intergenic
1071552610 10:86578735-86578757 TGCCTCAGCCTCTGAGTAGCAGG + Intergenic
1072100887 10:92227999-92228021 TGCCTTAGCCTCTGAGTAGCTGG + Intronic
1072110365 10:92313807-92313829 TGCCTTAGCCTGTGAGGTGGAGG + Intronic
1072154917 10:92715441-92715463 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1072232753 10:93426772-93426794 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072418152 10:95266081-95266103 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072454446 10:95563520-95563542 TGCCTGAGCCTGGGAGGCGGAGG + Intergenic
1072460839 10:95617161-95617183 TTCTTGAGCCTGGGAGGCGGAGG + Intronic
1072696551 10:97608195-97608217 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1072907507 10:99467976-99467998 TGCTGGAGTCTCTGAGGAGGGGG + Intergenic
1072908342 10:99476365-99476387 TCCCTGAGCCTGGGAGGTGGAGG + Intergenic
1073104261 10:101023318-101023340 TTCCTGAGCCAGCGAGCAGGAGG + Intronic
1073223328 10:101894680-101894702 TTTCTGAACCTTTGGGGAGGGGG + Intronic
1073224631 10:101907494-101907516 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1073836554 10:107450679-107450701 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1074295731 10:112186628-112186650 TGCTTGAACCTGTGAGGAGGAGG - Intronic
1074787920 10:116857750-116857772 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1074799202 10:116981942-116981964 TGCCTTAGCCTCTGAGTAGCTGG - Intronic
1075003839 10:118816844-118816866 CACCTAAGCCTCTGGGGAGGCGG - Intergenic
1075028905 10:119007822-119007844 TTCCTCAGCCTCCGAGTAGCTGG + Intergenic
1075431387 10:122384870-122384892 TGCTTGAGCCTGTGAGGTGGAGG + Intronic
1075446043 10:122513840-122513862 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1075469471 10:122677352-122677374 TTCCTGACTCTCTGCAGAGGAGG + Intergenic
1075851048 10:125587238-125587260 TGCCTGAGCCTCTGAGTAGCTGG - Intronic
1076054903 10:127364478-127364500 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1076142972 10:128094201-128094223 TGCCTCAGCCTCTGAGGAGCTGG - Intergenic
1076303135 10:129442925-129442947 TTCCTGAGCCAGCGAGGAGTTGG + Intergenic
1077329675 11:1978634-1978656 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1078199348 11:9166160-9166182 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
1078592712 11:12658969-12658991 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
1079506747 11:21161451-21161473 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1079795660 11:24799479-24799501 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1079869444 11:25779171-25779193 CTGCTGAGCCACAGAGGAGGTGG + Intergenic
1080101001 11:28459286-28459308 TTCATAAGCCTCTGTGGAGTGGG + Intergenic
1080253007 11:30257243-30257265 TTAGTGAGCATCTGTGGAGGTGG - Intergenic
1080349132 11:31361593-31361615 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1080638093 11:34140818-34140840 TTCCTGAACCTCTGCTAAGGTGG - Intronic
1081403258 11:42666878-42666900 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1081594649 11:44450751-44450773 TGCAGGAGCCTCTGAGGAGCTGG + Intergenic
1081634445 11:44711519-44711541 TTCCTGATTCTCAGAGAAGGGGG - Intergenic
1081640264 11:44748312-44748334 TTCCTGAACCCCAGAGGCGGCGG + Intronic
1082265988 11:50119014-50119036 TTCCTGAGGCAGTGAGGAAGGGG + Intergenic
1082290100 11:50359558-50359580 TTCCTGAGGCAGTGAGGAAGGGG - Intergenic
1083088377 11:60174408-60174430 TACCTGAGCCTGGGAGGTGGCGG - Intronic
1083386917 11:62317870-62317892 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1083807023 11:65080525-65080547 TACCTCAGCCTCTGAGTAGCCGG + Intronic
1083953652 11:65970870-65970892 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953685 11:65970989-65971011 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953694 11:65971021-65971043 TTCATGAGGTGCTGAGGAGGGGG + Intronic
1083953720 11:65971111-65971133 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953727 11:65971140-65971162 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953743 11:65971201-65971223 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953767 11:65971291-65971313 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953776 11:65971323-65971345 TTCAGGAGCTGCTGAGGAGGGGG + Intronic
1083953792 11:65971384-65971406 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953800 11:65971416-65971438 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953808 11:65971448-65971470 TTCATGAGCTGCTGAGGAGGGGG + Intronic
1083953839 11:65971567-65971589 TTCATGAGCTGCTGAAGAGGGGG + Intronic
1083953848 11:65971599-65971621 TTCAGGAGCTGCTGAGGAGGGGG + Intronic
1083999199 11:66287065-66287087 TTCCTGACCCCCTGAGCAAGTGG - Intronic
1084082970 11:66841230-66841252 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1084540679 11:69784601-69784623 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1084621502 11:70273161-70273183 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1084777047 11:71384105-71384127 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1085297027 11:75437117-75437139 TTCCAGAGCCTCTCTGGATGTGG + Intronic
1086290903 11:85308038-85308060 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1086676273 11:89610895-89610917 TTCATGAGCCTATGAAGAGAAGG + Intergenic
1087669877 11:101093572-101093594 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1087802226 11:102516823-102516845 TTTCAAAGCCTCTGAGGAGTTGG + Intergenic
1088276451 11:108091603-108091625 CGCCTGAGCCTGTGAGGTGGAGG + Intronic
1088678268 11:112217474-112217496 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1088741176 11:112768528-112768550 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1088931753 11:114358427-114358449 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1089232883 11:116995345-116995367 CTCCTGAGCCTGGGAGGTGGAGG - Intronic
1089273541 11:117317265-117317287 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1090197199 11:124826879-124826901 TGCCTTAGCCTCTGAGTAGCTGG + Intergenic
1090242660 11:125194953-125194975 TTCCTGACGCTCTTAGGAGGCGG + Intronic
1090796326 11:130138667-130138689 TGCTTGAGCCCCAGAGGAGGAGG - Intronic
1091002029 11:131917799-131917821 GTCCTGTGGCTCTGAGGAGCAGG + Intronic
1202812653 11_KI270721v1_random:33813-33835 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1091609277 12:1989597-1989619 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1091638985 12:2220011-2220033 TCCCTCAGCATCTGAGGAGGAGG - Intronic
1091774393 12:3174989-3175011 TTCCTTATTTTCTGAGGAGGTGG + Intronic
1092084329 12:5743168-5743190 TCCCTGAGCGTATGAGGAGAAGG - Intronic
1092200615 12:6580111-6580133 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1092255840 12:6926585-6926607 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1092324397 12:7514350-7514372 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1092364987 12:7870547-7870569 TTCCTGAGTCTATTAGGAGGAGG + Intronic
1093046747 12:14455062-14455084 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1093299134 12:17431685-17431707 TTTCTGAGCCTGGGAGGCGGAGG + Intergenic
1093372830 12:18385650-18385672 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
1094188544 12:27671955-27671977 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1094604070 12:31935653-31935675 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1094633836 12:32204264-32204286 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
1095172980 12:39056913-39056935 TGCCTCAGCCTCTGAGTAGATGG + Intergenic
1095277056 12:40298656-40298678 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1095502513 12:42856029-42856051 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1095503271 12:42864616-42864638 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1095836468 12:46644758-46644780 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1095919865 12:47518293-47518315 TGCCTGAGCCTAGGAGGTGGAGG - Intergenic
1096005979 12:48172214-48172236 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1096135688 12:49198468-49198490 TACCTCAGCCTCCGAGTAGGTGG + Intronic
1096367318 12:51039611-51039633 TGCCTTAGCCTCTGAGTAGCTGG - Intergenic
1096582515 12:52596663-52596685 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1096690455 12:53317626-53317648 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1096825641 12:54275324-54275346 TTGCTGAGCCTGGGAGGCGGAGG - Intronic
1097087883 12:56482145-56482167 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
1097108765 12:56642108-56642130 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1097226178 12:57477926-57477948 TTCCTGTGGCCCTGAGGTGGGGG - Intronic
1097662933 12:62450074-62450096 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1097932725 12:65207417-65207439 TTACTGAGATTCTGAGAAGGGGG + Intronic
1098312675 12:69163452-69163474 TGCTTGAACCTGTGAGGAGGAGG - Intergenic
1098458446 12:70703464-70703486 TTCCTGTGCTTCTGAGTAGGAGG + Intronic
1098548708 12:71739535-71739557 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1098855936 12:75653284-75653306 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1099476364 12:83112020-83112042 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1099610377 12:84860492-84860514 TTCCTTAGACTCTGAAGCGGTGG + Exonic
1099851405 12:88101537-88101559 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1100060969 12:90575425-90575447 TTCCTGTGGGTCTGTGGAGGTGG - Intergenic
1100322150 12:93506008-93506030 TGCTTGAGCCTATGAGGCGGAGG - Exonic
1100617696 12:96243727-96243749 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1100748939 12:97675617-97675639 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1100812607 12:98354189-98354211 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1101007900 12:100419417-100419439 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1101365807 12:104069220-104069242 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
1101461546 12:104901631-104901653 TGCTTGAGCCTGGGAGGAGGTGG - Intronic
1101717022 12:107320180-107320202 GTCCCAAGCCGCTGAGGAGGCGG + Intronic
1101761671 12:107663913-107663935 TTCTTGAGCCTGGGAGGCGGAGG - Intergenic
1101924912 12:108963599-108963621 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1101998227 12:109540289-109540311 TGCTTGAGCCTCGGAGGCGGAGG - Intergenic
1102044201 12:109819643-109819665 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
1102424085 12:112826980-112827002 TTCCTGAGCCACAGAGTAGATGG + Intronic
1102431889 12:112890249-112890271 CACCTAAGCCTCTGAGGAGGGGG + Intronic
1102577368 12:113864356-113864378 TTCTTGAGCATCTGAGGAAGAGG - Intronic
1102795832 12:115688113-115688135 TTCTTGAGCCTGAGAGGTGGAGG - Intergenic
1103357221 12:120330681-120330703 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1103620683 12:122185358-122185380 TGCCTAAGCCTCTGAGTAGCTGG - Intronic
1103642555 12:122363647-122363669 TACCTGGGCGTCTGGGGAGGGGG - Intronic
1103876311 12:124130256-124130278 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1103964963 12:124632785-124632807 TCCTGGAGCCTGTGAGGAGGAGG + Intergenic
1105028750 12:132868373-132868395 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1105219319 13:18310825-18310847 TGCCTGAGCCACTCAGAAGGTGG + Intergenic
1105449454 13:20486000-20486022 TTCCTGAGTCTGGGAGGTGGAGG - Intronic
1105731377 13:23220364-23220386 TGCCTGAGCCAGGGAGGAGGAGG + Intronic
1105956191 13:25285646-25285668 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1105966570 13:25390106-25390128 TACCTCAGCCTCTGAGTAGCTGG + Intronic
1106176961 13:27339936-27339958 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
1106342561 13:28844698-28844720 TACCTGAGCCTAGGAGGCGGAGG - Intronic
1106743335 13:32671858-32671880 TTCCTGAGTCTCAGCGGAGAAGG - Intronic
1106934948 13:34707482-34707504 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1107127229 13:36858664-36858686 TTCTTGATCCTGTGAGGATGGGG - Intronic
1107132657 13:36912650-36912672 TTCCTGAGTCTGTCAGGAGGAGG - Intronic
1107922611 13:45225502-45225524 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1108207620 13:48106685-48106707 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1109213832 13:59565022-59565044 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1110098545 13:71565033-71565055 TACCTCAGCCTCTGAGTAGCTGG + Intronic
1110386355 13:74915646-74915668 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1110593112 13:77287297-77287319 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1110762326 13:79244343-79244365 CTCCTGAGCCTGGGAGGTGGGGG - Intergenic
1111784527 13:92770329-92770351 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
1112351204 13:98635130-98635152 TTCCTCAGCCTCTGAGTAGCTGG - Intergenic
1112499761 13:99933670-99933692 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
1112535996 13:100256119-100256141 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1113053861 13:106245890-106245912 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1113273370 13:108700216-108700238 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1113452469 13:110420999-110421021 ATCCTGAGCTTCTGATGAGATGG - Intronic
1113960487 13:114123116-114123138 TCCTGGAGCCTCAGAGGAGGGGG + Intronic
1114478903 14:23019022-23019044 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1114512296 14:23272492-23272514 TTCTTAGGCCTCTGAGGAGGTGG - Exonic
1114623149 14:24111063-24111085 ATCTTGAGCCTATGAGGTGGAGG - Intronic
1114693646 14:24607487-24607509 TTCCTGTGCCTTAGAGGAGAGGG - Intronic
1114696588 14:24632199-24632221 TTCCTATGCCTCAGAGGAGAGGG - Intronic
1114763269 14:25342168-25342190 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1114993661 14:28318959-28318981 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1115257321 14:31416986-31417008 TACCTCAGCCTCTGAGTAGCAGG - Intronic
1115536606 14:34379196-34379218 TTCCCCAGCCTCTGAGTAGCTGG + Intronic
1115561765 14:34589048-34589070 TGCCTGAACCTGTGAGGCGGAGG + Intronic
1115595875 14:34908718-34908740 TGCCTCTGCGTCTGAGGAGGTGG - Intergenic
1115727721 14:36235373-36235395 TTCTTGAGCCTGGGAGGTGGAGG - Intergenic
1115928802 14:38467619-38467641 GGCCTGAGCCTCTGGGGAAGTGG - Intergenic
1116827845 14:49689326-49689348 CTCTTGAGCCTCGGAGGCGGAGG + Intergenic
1117860671 14:60089811-60089833 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
1118280422 14:64423506-64423528 TGCCTCAGCCTCTGAGCAGCTGG + Intronic
1118618399 14:67592354-67592376 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
1118778298 14:68988340-68988362 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1118808265 14:69256236-69256258 TTCCAGAGCCTCTGCTGAGCAGG - Intergenic
1119597751 14:75951676-75951698 TGCCTGAGCCCCTGAGGTTGAGG + Intronic
1119822308 14:77627960-77627982 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1120423437 14:84316498-84316520 ATCTTGAGCCTCTGGGCAGGAGG - Intergenic
1120867275 14:89306479-89306501 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1121334159 14:93066920-93066942 GGGCTGAGACTCTGAGGAGGAGG - Intronic
1121815236 14:96923903-96923925 AGCCTGAGCCTCTGAGGGGAGGG - Intronic
1121815246 14:96923941-96923963 AGCCTGAGCCTCTGAGGGGAGGG - Intronic
1121827504 14:97022497-97022519 TTCCTGGGGCACTGAGCAGGGGG - Intergenic
1122108313 14:99477637-99477659 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1122144179 14:99679329-99679351 CTCCAGGGCCTCTGAGGATGGGG + Exonic
1122308835 14:100782058-100782080 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1122555870 14:102579713-102579735 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1122599986 14:102916475-102916497 TTCCTCAGCCTCTGCGGCGCCGG + Intergenic
1122699262 14:103576524-103576546 TTGCTGAGCATATGTGGAGGTGG + Intronic
1122702223 14:103597601-103597623 TACCTCAGCCTCTGAGTAGCTGG - Intronic
1122853574 14:104549040-104549062 TTTTACAGCCTCTGAGGAGGAGG + Intronic
1122882915 14:104698055-104698077 TTCCTGTGCCTGTGGGGAGGTGG + Intronic
1123185299 14:106511078-106511100 TTTCTGACACTCTGAGGATGTGG + Intergenic
1123204961 14:106703809-106703831 TTCCTGACTCTCTCAGGATGTGG + Intergenic
1123209962 14:106750250-106750272 TTCCTGACTCTCTCAGGATGTGG + Intergenic
1123680757 15:22761725-22761747 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1123692336 15:22848709-22848731 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1123862579 15:24484220-24484242 TGCCTCAGCCGCTGAGGAGCTGG + Intergenic
1124104983 15:26729359-26729381 TTCAGGAGCCTCCAAGGAGGGGG - Intronic
1124332965 15:28836183-28836205 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
1124616896 15:31248594-31248616 TCTCTGAGCCTCTGAGCAGGTGG + Intergenic
1125663032 15:41409157-41409179 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1125750124 15:42022190-42022212 TCCCTGAGCCTCTGAGGGGTTGG - Intronic
1126141400 15:45442416-45442438 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1126762638 15:51983363-51983385 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1127041592 15:54983036-54983058 TTACTGTGCCTTTGAGGAGAAGG - Intergenic
1127317198 15:57808297-57808319 TACCTGATCATCTGGGGAGGGGG + Intergenic
1127476254 15:59336254-59336276 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1127484141 15:59403995-59404017 TGCCTTAGCCTCTGAGTAGCTGG + Intronic
1127889312 15:63234743-63234765 TTCCTGCACCTCTGAGGAGAAGG - Intronic
1127966161 15:63924344-63924366 TTCCTCAGGGCCTGAGGAGGTGG + Intronic
1128202602 15:65822162-65822184 TTCTTGAGCCTGGGAGGCGGAGG + Intronic
1128832876 15:70785598-70785620 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1128933174 15:71723970-71723992 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1128933634 15:71727266-71727288 TTCCTGGGCATCTGAGGCTGTGG - Intronic
1129024300 15:72554835-72554857 TGCCTGAGCCTGGGAGGCGGAGG - Intronic
1129345732 15:74917236-74917258 TATCTCAGCCTCTGAGGAGCTGG - Intergenic
1129347140 15:74929648-74929670 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1129364917 15:75048355-75048377 TGCCAGAGCCTGTGGGGAGGTGG + Intronic
1129381989 15:75173897-75173919 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1129436130 15:75541921-75541943 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1129690960 15:77713124-77713146 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
1129905131 15:79181852-79181874 TGCCCCAGCCTCTGAGGAGCTGG - Intergenic
1130002661 15:80060228-80060250 GACCTGAGACTCGGAGGAGGCGG - Intronic
1130120852 15:81046409-81046431 TTCCTGAGCCTTGGAGGACCAGG - Intronic
1130366940 15:83249266-83249288 TGCCCCAGCATCTGAGGAGGTGG + Intergenic
1130548609 15:84874642-84874664 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1130558172 15:84937811-84937833 TTCTTGAACCTGGGAGGAGGAGG + Intronic
1130698738 15:86157517-86157539 TTCCTGTGGGTATGAGGAGGTGG + Intronic
1131381813 15:91970512-91970534 TTGCTGAGCCTGTGACCAGGAGG + Intronic
1131483572 15:92802212-92802234 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
1132173065 15:99683488-99683510 TGCCTGAGCCGCAGAGGTGGAGG - Intronic
1132551843 16:556820-556842 GTCCTGAGCCTCTGGGACGGAGG - Intergenic
1132911248 16:2313437-2313459 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1132974487 16:2704638-2704660 TGCCTGGGCGGCTGAGGAGGGGG + Intronic
1133023842 16:2979218-2979240 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1133060746 16:3173025-3173047 TTCCTCAGCTTCTGAGTAGCTGG + Intergenic
1133296650 16:4756628-4756650 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1133299163 16:4771557-4771579 TTCTTGAGCCTGGGAGGCGGAGG + Intergenic
1133570434 16:7034960-7034982 TTCCTCAGCCTCTGAGTAGCTGG + Intronic
1133605728 16:7385865-7385887 TGCTTCAGCCTCTGAGTAGGTGG + Intronic
1133688069 16:8185832-8185854 CTCTTGAGCCTCGGAGGCGGAGG + Intergenic
1134078965 16:11311918-11311940 TTCCTGACCCTGTGAGTGGGAGG - Intronic
1134087030 16:11364325-11364347 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1134448481 16:14348444-14348466 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1134492988 16:14710143-14710165 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1134498369 16:14749267-14749289 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1134541132 16:15066547-15066569 TGCATGAGCCTCGGAGGTGGTGG + Intronic
1134582208 16:15379828-15379850 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1134776555 16:16858682-16858704 TGCTTGAGCCTGTGAGGCGGAGG - Intergenic
1135015423 16:18920754-18920776 TTACTGAGCCTGGGAGGTGGAGG + Intronic
1135313526 16:21423884-21423906 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1135366450 16:21856162-21856184 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1135445365 16:22515002-22515024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1135602692 16:23796672-23796694 TACCTGAGCCCAGGAGGAGGAGG - Intergenic
1135696289 16:24589792-24589814 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1135804779 16:25533010-25533032 TGCCTGAGTCTCTAAGGAGAAGG - Intergenic
1135832709 16:25790293-25790315 TGCCTCAGCCTCTGAGTAGATGG - Intronic
1135863412 16:26078253-26078275 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1135989220 16:27207293-27207315 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136002909 16:27309628-27309650 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1136152672 16:28361605-28361627 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136194079 16:28639568-28639590 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1136210410 16:28753676-28753698 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1136310192 16:29402587-29402609 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136319459 16:29473322-29473344 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
1136323637 16:29504389-29504411 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1136434030 16:30212666-30212688 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
1136438322 16:30244358-30244380 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1137230879 16:46566048-46566070 CTCCTCAGCCTCTGAGTAGCTGG - Intergenic
1137280225 16:46970649-46970671 TTCTTGAACCTGAGAGGAGGGGG + Intronic
1137407563 16:48201864-48201886 TCCTTGAGGCTCTGAGGAAGTGG + Intronic
1137529619 16:49270198-49270220 CTCCTGAGCTCCTGAGGAGAGGG + Intergenic
1138019369 16:53463680-53463702 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1138035576 16:53602658-53602680 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1138110886 16:54322932-54322954 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1138675007 16:58644879-58644901 TTCCTGTGACTCTGAGGAGAGGG + Intergenic
1139386817 16:66578375-66578397 CTCCAGAGCCGCTGAGAAGGGGG - Intronic
1139417666 16:66827452-66827474 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1139443410 16:66980596-66980618 TGCTTGAGCCTCGGAGGCGGAGG - Intergenic
1139720550 16:68849248-68849270 TGCTTGAGCCCCTGAGGCGGAGG + Intronic
1139724831 16:68888924-68888946 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1139785211 16:69386883-69386905 TTACTGGGCCTCTCAGGAAGAGG - Intronic
1139857875 16:69994989-69995011 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1140571617 16:76113121-76113143 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1140760662 16:78105883-78105905 TTCCTGAACCTGGGAGGTGGAGG - Intronic
1141078369 16:81029687-81029709 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1141388713 16:83646585-83646607 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1141429110 16:83961787-83961809 TGCCCCAGCCTCTAAGGAGGGGG + Intronic
1141552891 16:84818005-84818027 TGCCTGAGCCTGGGAGGTGGAGG - Intergenic
1141801973 16:86315880-86315902 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1142015523 16:87744329-87744351 TGCTTGAACCTCTGAGGTGGAGG + Intronic
1142124355 16:88402760-88402782 TTCCAGGGCCTCTGATGAGCTGG + Intergenic
1142311281 16:89315460-89315482 CTGCTGAGCTCCTGAGGAGGTGG - Intronic
1142420883 16:89969112-89969134 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1142442298 16:90106634-90106656 TTCCTGAGGAGCTGAGGAGAAGG - Intergenic
1142668986 17:1478787-1478809 TGCCTGAGCCTGGGAGCAGGTGG - Intronic
1142701416 17:1664112-1664134 CTCCTGAGCCTGGGAGGTGGAGG - Intronic
1142724563 17:1803027-1803049 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1142832561 17:2559913-2559935 TACCTGAGCCTGGGAGGAGGAGG + Intergenic
1143440819 17:6972067-6972089 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1143568846 17:7741776-7741798 TGCCTTAGCCTCTCAGGAGCTGG + Intronic
1143647711 17:8242141-8242163 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1143864974 17:9917114-9917136 CTCCTGGGCCACTGAGGAGAGGG - Exonic
1144325015 17:14170701-14170723 TGCCTCAGCCTCTAAGGAGCTGG - Intronic
1144516928 17:15924986-15925008 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1144565743 17:16357756-16357778 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1144598952 17:16596494-16596516 TACCAGAGCCTGGGAGGAGGGGG + Intergenic
1144869383 17:18359566-18359588 TACTTGAGCCTCAGAGGTGGAGG + Intronic
1145093049 17:20001635-20001657 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1145182172 17:20762849-20762871 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1146219804 17:31008582-31008604 GTCCTGAGCCGCGGAGGACGCGG - Intergenic
1146267844 17:31464842-31464864 TGCCTGAGCCTGGGAGGCGGAGG - Intronic
1146493158 17:33296840-33296862 ATTCTGAGCCTCTGAGTAGCAGG - Intronic
1146927984 17:36758091-36758113 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1146944337 17:36863789-36863811 TGCCTGAGCCTCTGTGGCTGTGG - Intergenic
1147061907 17:37886739-37886761 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1147280735 17:39358566-39358588 TGCCTTAGCCTCTGAGTAGGTGG - Intronic
1147296658 17:39489002-39489024 TGCTTGAGCCTAGGAGGAGGAGG - Intronic
1147408495 17:40231536-40231558 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1147625814 17:41899159-41899181 TGCCTGAGCCTCCGAGTAGCTGG - Intronic
1147772585 17:42878157-42878179 TTCTTGAGCCTGGGAGGCGGAGG + Intergenic
1147946528 17:44083482-44083504 GTCCTCTGCCTCTGAGGAGCAGG + Intronic
1148045978 17:44745013-44745035 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
1148116482 17:45178256-45178278 CTCTTGAGCCTCTGAGAAAGAGG + Intergenic
1148490228 17:48018729-48018751 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1148622640 17:49045876-49045898 TCCCTGAGCCTGAGAAGAGGAGG - Exonic
1148896729 17:50843243-50843265 TCCCTGGGCCTCTGAGGACAGGG - Intergenic
1148901297 17:50879982-50880004 TGCCTGAACCTGTGAGGTGGAGG - Intergenic
1149085830 17:52714957-52714979 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1149227141 17:54486358-54486380 AACCTGAGTCTCTGAGGTGGGGG - Intergenic
1149596765 17:57868774-57868796 TTGCTAAGCCTCTGTGGGGGTGG - Intronic
1149624661 17:58072244-58072266 TGCCTCAGCCTCAGAGTAGGTGG - Intergenic
1150382796 17:64733897-64733919 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1150736984 17:67749433-67749455 TTCCTCAGCCTCTCAAGTGGTGG + Intergenic
1151044701 17:70905569-70905591 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1151064551 17:71135061-71135083 TGCCTTAGCCTCTGAGTAGCTGG - Intergenic
1151607506 17:75148327-75148349 TTGCTGAGCCTGGGAGGTGGAGG - Intronic
1151663832 17:75534232-75534254 CTCCTGGGCCTGTGAGGATGGGG - Intronic
1151690069 17:75678262-75678284 ACCTTGAGCATCTGAGGAGGGGG - Intronic
1151710028 17:75798950-75798972 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1151920716 17:77153179-77153201 TGCCTCAGCCTCTGAGTAGCCGG + Intronic
1152090707 17:78245837-78245859 TGCTTGAGCCTCCCAGGAGGTGG - Intergenic
1152092103 17:78252743-78252765 TGCAGGAGGCTCTGAGGAGGGGG - Intergenic
1152231429 17:79115794-79115816 TCCCGGAGCCCCTGAGGATGGGG + Intronic
1152239648 17:79154750-79154772 TTCCTGCTTCTCTGAGGAAGGGG + Intronic
1152713794 17:81888492-81888514 TTCCGGGGCCTCTGGGGAAGGGG - Intronic
1152813796 17:82395113-82395135 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
1153369449 18:4297565-4297587 ATCCTGAGCCTCTGAGCAAAGGG + Intronic
1153492803 18:5667062-5667084 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1153940235 18:9970450-9970472 TTTCTCACCCTCTGAGGAGTTGG + Intergenic
1154004896 18:10518856-10518878 TTCCTGTGGAGCTGAGGAGGAGG - Intergenic
1154012969 18:10591291-10591313 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1154119324 18:11638242-11638264 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1154933434 18:21025620-21025642 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1155030697 18:21981096-21981118 TTCCAGAGGCTCTGATGAGTAGG - Intergenic
1155046853 18:22110315-22110337 TTCTTGAGCCTGGGAGGCGGAGG + Intergenic
1155355873 18:24953586-24953608 TTCCTGAGTAGCTGAGTAGGTGG + Intergenic
1155431526 18:25764477-25764499 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1155640417 18:28007044-28007066 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1156444575 18:37225859-37225881 TACCTGTGCCTCTGAGGGGCAGG - Intronic
1156634023 18:39006261-39006283 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1156814171 18:41288895-41288917 TTCTTGAGCCTCTGAGGTCAAGG + Intergenic
1156835929 18:41554540-41554562 TTACAGAGTCTGTGAGGAGGAGG + Intergenic
1157233973 18:45945809-45945831 TTCCTGAGACTTGCAGGAGGAGG - Intronic
1157280599 18:46344411-46344433 CCCCTGAGCTTTTGAGGAGGGGG - Intronic
1157607783 18:48936963-48936985 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
1157790388 18:50525868-50525890 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
1157833473 18:50878710-50878732 TGCCTGAGCCACAGAGGAAGGGG - Intergenic
1158930402 18:62319583-62319605 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1159379515 18:67638017-67638039 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1159593513 18:70360573-70360595 TGCCTCAGCCTCTGAGTAGCCGG + Intergenic
1159601509 18:70432508-70432530 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1159601861 18:70435832-70435854 TTCCTCAGCCTCCGAGTAGCTGG - Intergenic
1159886280 18:73910555-73910577 TTTGTCAGCCTCTGAGGATGGGG - Intergenic
1160003097 18:75046383-75046405 AGCCTAAGCCTCTGAGGATGTGG - Intronic
1160143425 18:76346562-76346584 TTCCGGAGCCCGTGGGGAGGTGG - Intergenic
1160223461 18:76993464-76993486 TGCTTGAACCTCTGAGGCGGAGG + Intronic
1160232715 18:77060317-77060339 TTCATGTGCCTCTGAGGACCTGG - Intronic
1160313806 18:77821744-77821766 TGCCTGAGCCTGGGAGGTGGAGG + Intergenic
1161043317 19:2121546-2121568 TTCCAGGGCCTGTGTGGAGGGGG - Intronic
1161046962 19:2140128-2140150 GTCCTGACCCTTTGAGCAGGAGG - Intronic
1161098668 19:2409251-2409273 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1161371197 19:3912769-3912791 TCCCTCAGCCTCTGAGTAGCTGG - Intronic
1161739762 19:6013631-6013653 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1161821912 19:6534861-6534883 GTTCCGAGCCTCGGAGGAGGCGG - Exonic
1161823986 19:6549973-6549995 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1162003823 19:7764902-7764924 TTCCTGTTCCACTGGGGAGGTGG + Intronic
1162303979 19:9860358-9860380 CTCCTCAGCCTCTGAGTAGCTGG - Intronic
1162464551 19:10832087-10832109 TTCCTTAGCATGTGAGGAGTGGG + Intronic
1162514044 19:11137774-11137796 TTCCAGAGCCCCTGGGGAGGGGG - Intronic
1162536665 19:11266532-11266554 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1162888224 19:13712401-13712423 TTCATTAGGCTCTCAGGAGGAGG - Intergenic
1163119464 19:15208330-15208352 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1163212427 19:15851106-15851128 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1163342112 19:16715433-16715455 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1163364939 19:16870663-16870685 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1163586027 19:18164010-18164032 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163594819 19:18214833-18214855 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163706500 19:18817057-18817079 TGCTTGAGCCTGTGAGGCGGAGG + Intergenic
1163716803 19:18877669-18877691 TTCCTGGGCCTGGGAGGCGGCGG + Intronic
1163754105 19:19096303-19096325 TCCCTGAGCCTGTTTGGAGGGGG - Intronic
1163839323 19:19596273-19596295 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1163839435 19:19597097-19597119 TGCCTCAGCCTCTGAGTAGCCGG - Intronic
1164209612 19:23087697-23087719 TGCTTGAGCCTCAGAGGTGGAGG - Intronic
1164315544 19:24085044-24085066 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
1165039546 19:33059380-33059402 TGCCTGAACCTGTGAGGTGGAGG - Intronic
1165164941 19:33846135-33846157 TTCTTGAGCCTGGGAGGCGGAGG + Intergenic
1165774148 19:38395161-38395183 CTCCTGCGCCTTTAAGGAGGAGG + Intronic
1165906505 19:39197658-39197680 TGCCTGAGCCTGGGAGGCGGAGG - Intronic
1165996987 19:39850614-39850636 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1166837892 19:45678269-45678291 TTCGTGCCCCTCTGGGGAGGAGG - Intronic
1167028985 19:46944183-46944205 TACCTCAGCCTCTGAGTAGCTGG - Intronic
1167106140 19:47430838-47430860 TGCCGGAGCCTCTGAGTAGCTGG + Intronic
1167230748 19:48281608-48281630 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
1167351958 19:48980997-48981019 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1167417471 19:49383425-49383447 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1167659225 19:50786148-50786170 TTCCTGGGCCTCTGAGCCAGAGG + Intergenic
1167700805 19:51044235-51044257 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1167806548 19:51790325-51790347 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1168048956 19:53814464-53814486 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1168208577 19:54871385-54871407 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
1168628014 19:57934326-57934348 TGCCTTAGCCTCTGAGTAGCTGG + Intronic
1168660337 19:58160670-58160692 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
925195779 2:1924085-1924107 TTCCTGAGGCTGTGAGATGGAGG - Intronic
925359142 2:3265320-3265342 TTCATCTGCCTCTGAGGATGTGG - Intronic
926303394 2:11619383-11619405 TGCGTGAGCCTGTGGGGAGGAGG + Intronic
926859374 2:17292187-17292209 TTTCTGAGCCTGTGAGGGAGAGG + Intergenic
926943223 2:18159938-18159960 TAAATGAGCCTCAGAGGAGGAGG + Intronic
927349129 2:22086049-22086071 TGCCTGAACCTGTGAGGTGGAGG + Intergenic
927394463 2:22633170-22633192 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
927497617 2:23561375-23561397 CTCCTGAGCCTCTGAGCATAAGG - Intronic
927517815 2:23682316-23682338 ACCCTGAGGCTCTGAGGATGTGG + Intronic
927728172 2:25444449-25444471 TTCTTGAACCTGGGAGGAGGAGG + Intronic
927949984 2:27160888-27160910 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
928325463 2:30316178-30316200 TTCTTGAGCCTAGGAGGTGGAGG - Intronic
928399969 2:30970779-30970801 TTTTTGAGCCTGTGAGGTGGGGG - Intronic
928531678 2:32198991-32199013 TTCCAGGGGCTGTGAGGAGGAGG - Intronic
929157171 2:38798827-38798849 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
929167173 2:38894216-38894238 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
929504730 2:42519657-42519679 ATCCTCAGCCTCTGAGTAGCTGG - Intronic
929988093 2:46757750-46757772 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
930155818 2:48106750-48106772 TTCCAGAGCCTCTATGGAGGAGG - Intergenic
930162131 2:48169197-48169219 TGCCTGAGTCTGAGAGGAGGGGG - Intergenic
930744141 2:54863435-54863457 TGCTTGAGCCCCGGAGGAGGAGG + Intronic
931366694 2:61625353-61625375 TTCTTGAACCTGTGAGGTGGAGG + Intergenic
931400907 2:61930470-61930492 TTCTTGAACCTGTGAGGCGGAGG + Intronic
931457841 2:62426149-62426171 TTTCTGAGCCTCTGGGGAAGGGG - Intergenic
931495768 2:62805596-62805618 TGCCTGAACCTTGGAGGAGGAGG - Intronic
932242401 2:70167655-70167677 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
932289159 2:70560793-70560815 ATCTTGTGACTCTGAGGAGGAGG + Intergenic
932331238 2:70899691-70899713 CTCCTCAGCCTCGGAGAAGGCGG + Intergenic
932698139 2:73974262-73974284 TGCCTGAGCCTGAGAGGTGGAGG - Intergenic
932767022 2:74477230-74477252 TGCCTCAGCCTCTGAGCAGCTGG + Intronic
932904856 2:75738686-75738708 GTCCCAAGCCTCTGAGGAGCTGG + Intergenic
933718681 2:85382322-85382344 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
934184731 2:89661688-89661710 TGCCTGAGCCACTCAGAAGGTGG - Intergenic
934295014 2:91735821-91735843 TGCCTGAGCCACTCAGAAGGTGG - Intergenic
934679187 2:96270386-96270408 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
934868041 2:97831751-97831773 TGCCTGAACCTCAGAGGTGGAGG - Intronic
935245519 2:101215862-101215884 TGCCTCAGCCTCTGGGGAGCTGG - Intronic
935282595 2:101532047-101532069 TGCCTCAGCCTCTGAGTAGCCGG - Intergenic
935307404 2:101750739-101750761 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
936037030 2:109121131-109121153 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
936045385 2:109183948-109183970 TAACTGAGGCTCTGAGGAGCTGG - Intronic
936481930 2:112892381-112892403 TTCCTGAGCCCCAGTGGAGTAGG - Intergenic
937105367 2:119307323-119307345 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
937448817 2:121983124-121983146 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
937503369 2:122508172-122508194 TGCTTGAGCCTCGGAGGTGGAGG + Intergenic
937759549 2:125584115-125584137 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
937941063 2:127286431-127286453 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
938000839 2:127735285-127735307 TTCCTTAGGATCTGATGAGGTGG - Intronic
938034438 2:128024763-128024785 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
939131067 2:138236642-138236664 TGCCTCAGCCTCTGAGTAGATGG - Intergenic
939201573 2:139042328-139042350 TTCCAGGTCCACTGAGGAGGTGG - Intergenic
940078571 2:149772432-149772454 TGCCTCAGCCTCTGAGCAGCTGG - Intergenic
940358993 2:152777107-152777129 TGCCTGAGCCTGGGAGGTGGAGG - Intergenic
940760603 2:157734499-157734521 TCCTTGGGCCTCTGAGGAGGAGG + Intergenic
941928908 2:170922000-170922022 TTCCTCAGCCTCTGAGTAGGTGG - Intergenic
942255365 2:174091757-174091779 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
942588538 2:177514083-177514105 GTCCTGAGCCTTTTAGGAGTAGG + Intronic
942680439 2:178472732-178472754 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
942764136 2:179434049-179434071 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
942767979 2:179479723-179479745 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
943192258 2:184694041-184694063 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
943716404 2:191157067-191157089 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
944110791 2:196129634-196129656 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
944241727 2:197492302-197492324 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
944620546 2:201510358-201510380 TGCCTGAACCTGGGAGGAGGAGG + Intronic
945093658 2:206199314-206199336 TGCTTGAGCCTCGGAGGTGGAGG + Intronic
945097488 2:206233324-206233346 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
945164760 2:206931190-206931212 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
945668567 2:212773634-212773656 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
945914518 2:215689068-215689090 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
945914539 2:215689202-215689224 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
946451515 2:219784211-219784233 TTTGTGTGCCTCTGAGGAAGGGG + Intergenic
946601459 2:221364413-221364435 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
946758122 2:222966523-222966545 TGCCTGAGCCTCAGAGGTTGAGG + Intergenic
946818986 2:223610801-223610823 TGCCTCAGCCTCTCAGGTGGTGG - Intergenic
947100331 2:226614072-226614094 GTCTTAAGCCTCAGAGGAGGTGG - Intergenic
947112106 2:226729855-226729877 TGCTTGAGCCTCTGAGGTTGAGG - Intergenic
947202403 2:227626454-227626476 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
947403325 2:229750108-229750130 TTCCTGAGGCCCTGACCAGGGGG + Intergenic
947504002 2:230693129-230693151 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
947582410 2:231329422-231329444 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
947882446 2:233529912-233529934 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
948426839 2:237893822-237893844 TTCCTCAGCCTCCGAGTAGCTGG - Intronic
948431080 2:237919546-237919568 TTCCTGGGCCTGTGCGGAGGTGG + Intergenic
948483459 2:238264735-238264757 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
948532469 2:238618646-238618668 TTCTTGATTCTCTGTGGAGGCGG + Intergenic
948904034 2:240969355-240969377 GCCCTGAGCCTCTGAGGAGGTGG + Intronic
1169454588 20:5741034-5741056 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1169915295 20:10676729-10676751 TTCCTCATTCTCTAAGGAGGGGG - Intergenic
1170450747 20:16481050-16481072 GTCCTGAGCCTCAGAAGAGTTGG - Intronic
1170757402 20:19216493-19216515 TGCCTGAGACTCTGAGTAGCTGG - Intronic
1170848159 20:19979928-19979950 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1172045471 20:32076969-32076991 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1172103965 20:32504716-32504738 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1172614771 20:36275783-36275805 TTCCTGAGCCCCAGGTGAGGGGG + Intergenic
1172957552 20:38771743-38771765 TGCCTGGGCATCTGAGGAGCGGG - Exonic
1173199552 20:40944449-40944471 TTCCTCAGCCTCGAAGCAGGAGG + Intergenic
1173549383 20:43921883-43921905 TTCCTGAGCCTCTGGGTTGAAGG + Intronic
1173587564 20:44194736-44194758 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1173603921 20:44316029-44316051 TGCCTCAGCCTCTGAGCAGCTGG + Intergenic
1173748026 20:45452948-45452970 TACCTCAGCCTCTGAGCAGCTGG - Intergenic
1173922943 20:46759425-46759447 TTCCTGGGCCTTTGGGCAGGTGG + Intergenic
1173985895 20:47261104-47261126 TGCCTGAGCCTCCGAGTAGCTGG - Intronic
1174000927 20:47374154-47374176 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1174160664 20:48548091-48548113 TCCCTGAGGCTCCGAGAAGGGGG - Intergenic
1174224567 20:48986498-48986520 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1174469000 20:50741654-50741676 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1174513491 20:51073820-51073842 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1174649485 20:52112568-52112590 GTCCTGGGCCTCTGGGGATGTGG + Intronic
1174813399 20:53666372-53666394 TTCCTGAGCCTGGGAGGTTGAGG - Intergenic
1174861987 20:54099603-54099625 TCCCTGAGTGCCTGAGGAGGGGG + Intergenic
1175233252 20:57489701-57489723 TGCCTCAGCCTCTGAGGAGCAGG + Intergenic
1175289267 20:57862969-57862991 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1175428356 20:58885248-58885270 TTCCTGACTCTCTGATGGGGAGG - Intronic
1176359419 21:5982625-5982647 TTCCTGAGCCCCTGAGCAGCAGG + Intergenic
1176882447 21:14213854-14213876 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1177412700 21:20750749-20750771 ATCCTGAGCCTCTAAGATGGAGG - Intergenic
1177546435 21:22564242-22564264 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
1177878336 21:26662080-26662102 TGCCTGAGCCTGGGAGGTGGAGG + Intergenic
1177932362 21:27300653-27300675 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1178077764 21:29028235-29028257 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1178307120 21:31500049-31500071 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178373777 21:32049837-32049859 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1178461691 21:32807914-32807936 TTCCTGTGAATCTGATGAGGAGG + Intronic
1178478939 21:32962434-32962456 TTACTGAGCCCCTGGGGAAGAGG - Intergenic
1178511407 21:33207818-33207840 GTCCTGTGCCTGTGAGGAGCTGG + Intergenic
1178759004 21:35382424-35382446 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178850170 21:36206414-36206436 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1178962329 21:37076814-37076836 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1179764099 21:43555925-43555947 TTCCTGAGCCCCTGAGCAGCAGG - Intronic
1179832150 21:44003756-44003778 ATCCTGAGCCTGGGAGGTGGAGG - Intergenic
1180089195 21:45525123-45525145 GTCCTGATCCTCTGAGGGTGCGG - Intronic
1180188615 21:46152184-46152206 TTCAGGGCCCTCTGAGGAGGGGG - Intronic
1180651771 22:17383109-17383131 TGCCTCAGCCTCTGAGCAGCTGG - Intronic
1180685164 22:17660531-17660553 TGCCTCAGCCTCCGAGGAGCTGG + Intronic
1180736230 22:18019609-18019631 TGCCTGAGCCTGGGAGGCGGAGG + Intronic
1180740675 22:18051202-18051224 TCCCTCAGCCTCTGAGTAGCTGG - Intergenic
1180744487 22:18078310-18078332 TCCCGGAGCCTCTGGGGAGGCGG + Exonic
1180816919 22:18795685-18795707 TGCCTGAGCCACTCAGAAGGTGG + Intergenic
1180956498 22:19743666-19743688 TTCCACAGGCTTTGAGGAGGGGG - Intergenic
1181203108 22:21230030-21230052 TGCCTGAGCCACTCAGAAGGTGG + Intergenic
1181279791 22:21711135-21711157 TACCTCAGCCTCTGAGTAGCTGG + Intronic
1181283894 22:21738612-21738634 TGCCTCAGCCTCTGAGTAGCCGG - Intergenic
1181472319 22:23148253-23148275 TGCCTGAGCCTCTGTTGAGATGG - Intronic
1181498963 22:23304998-23305020 TGCCTCAGCCCCTGAGGAGCTGG - Intronic
1181565026 22:23730970-23730992 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1181644423 22:24223285-24223307 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1181845854 22:25708131-25708153 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1181978033 22:26746034-26746056 TGCCTGGGGCTGTGAGGAGGAGG + Intergenic
1182090536 22:27591592-27591614 GTCCTGAGCCTCAGAGTGGGAGG + Intergenic
1182164056 22:28154463-28154485 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1182591154 22:31381233-31381255 TGCCTTAGCCTCTGAGTAGCTGG + Intergenic
1182633829 22:31708738-31708760 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1182888716 22:33798174-33798196 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1182946726 22:34331140-34331162 TTCCTAAGTATCTGAGGTGGTGG + Intergenic
1183000052 22:34849255-34849277 CGCTTGAGCCTCAGAGGAGGAGG + Intergenic
1183067717 22:35374870-35374892 TCCCTCAGCCTCTGAGTAGTTGG - Intergenic
1183087998 22:35499054-35499076 TTCCGTAGCCTTTGAGGAAGGGG + Intergenic
1183128307 22:35806916-35806938 TACCTCAGCCTCTGAGTAGCTGG + Intronic
1183362888 22:37391854-37391876 CTCCTGAGTCTCAGAGGATGTGG - Intronic
1183745809 22:39691095-39691117 AGCCTGAGCCTCAGAGGAGAGGG + Intergenic
1183798762 22:40143609-40143631 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1183909877 22:41070734-41070756 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1184158184 22:42682685-42682707 TGCCAGAGCCTCTGAGCAGCTGG - Intergenic
1184171415 22:42761915-42761937 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1184185151 22:42859563-42859585 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
1184348799 22:43929678-43929700 TGCCTGAACCTGTGAGGTGGAGG - Intronic
1185005554 22:48274594-48274616 TGCTTGAGACTCGGAGGAGGGGG + Intergenic
1185241892 22:49751070-49751092 CATCTGAGTCTCTGAGGAGGTGG - Intergenic
1185335840 22:50270501-50270523 TTCCTGCGCCTCGGAGGCGGTGG + Intronic
1203223812 22_KI270731v1_random:65394-65416 TGCCTGAGCCACTCAGAAGGTGG - Intergenic
1203267018 22_KI270734v1_random:21406-21428 TGCCTGAGCCACTCAGAAGGTGG + Intergenic
949210307 3:1491154-1491176 TTGGTGAGCCAGTGAGGAGGTGG + Intergenic
949437079 3:4041184-4041206 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
949712933 3:6892584-6892606 TTCCTGAGCATCTGAGAGTGAGG + Intronic
950136604 3:10585378-10585400 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
950224040 3:11219002-11219024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
950355486 3:12404688-12404710 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
950659946 3:14461029-14461051 ATCCTGAGCCTCTCAGGCTGGGG - Intronic
950760060 3:15214602-15214624 TGCCTCAACCTCTGAGGAGCTGG - Intronic
951227048 3:20132257-20132279 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
952018846 3:28992672-28992694 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
952357409 3:32597352-32597374 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
952732765 3:36656535-36656557 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
952827585 3:37537146-37537168 GACCTGAACCTCTGAGGAGGGGG + Intronic
952940197 3:38438113-38438135 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
953153821 3:40350346-40350368 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
953161572 3:40425300-40425322 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
953363722 3:42323749-42323771 TTCCTGAACCCCAGAAGAGGTGG + Intergenic
953398615 3:42592312-42592334 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
954071394 3:48145478-48145500 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
954092193 3:48294186-48294208 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
954171045 3:48802587-48802609 TACCTCAGCCTCTGAGTAGCTGG - Intronic
954243939 3:49316086-49316108 TGCCTCAGCCTCTGAGTAGATGG - Intronic
954354918 3:50076769-50076791 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
954382806 3:50228436-50228458 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
954567255 3:51608972-51608994 TTCCTGAACCTGGGAGGGGGAGG - Intronic
954605944 3:51909686-51909708 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
954722010 3:52572484-52572506 TCCCTCAGCCTCTGAGTAGCCGG + Intronic
954728545 3:52637547-52637569 TGCTTGAGCCTCGGAGGTGGAGG + Intronic
954921645 3:54196082-54196104 TTCCTGATGCTCTGTAGAGGTGG + Intronic
955254763 3:57319661-57319683 TGCTTGAGCCTGTGAGGTGGAGG - Intronic
955278740 3:57573662-57573684 CTCTTGAGCCTGTGAGGCGGAGG - Intronic
955409024 3:58643959-58643981 TGCCTGGGCCTCTGAGGTGTTGG + Intronic
955770798 3:62383154-62383176 TGCCTGAGCCTGGGAGGTGGAGG + Intergenic
955776804 3:62442323-62442345 TGCCTCAGCCTCTCTGGAGGAGG + Intronic
956009044 3:64811036-64811058 CTCCTGAGCCTGGGAGGTGGAGG - Intergenic
956174978 3:66464437-66464459 ATCGTGAGCCTCTGAGAAGACGG - Intronic
956907985 3:73786768-73786790 TTCCTGAGGCAGTGAGGAAGGGG + Intergenic
957483747 3:80831590-80831612 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
958010683 3:87875333-87875355 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
958632778 3:96703141-96703163 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
958877220 3:99630028-99630050 TGCCTGAGCCTAGGAGGTGGAGG + Intergenic
959036755 3:101375426-101375448 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
959059869 3:101606381-101606403 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
959166737 3:102789439-102789461 TTCCTGGGCACCTGTGGAGGAGG + Intergenic
959427203 3:106205429-106205451 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
959443278 3:106406021-106406043 TGCCTGAACCCCGGAGGAGGAGG - Intergenic
960311896 3:116126745-116126767 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
960591222 3:119367741-119367763 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
960652506 3:119967190-119967212 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
960866974 3:122211622-122211644 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
960908109 3:122621880-122621902 TGCGTGAGCCTGGGAGGAGGAGG - Intronic
961755493 3:129124639-129124661 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
961766980 3:129219092-129219114 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
962121232 3:132562216-132562238 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
962522117 3:136206873-136206895 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
962755929 3:138465411-138465433 TTCCTGGGCAGGTGAGGAGGAGG + Exonic
962825545 3:139096970-139096992 TCTCTGAGTCTCTGAGGAAGAGG - Intronic
962887711 3:139642766-139642788 TTCCTCACCCTCTGAAGAGGGGG - Intronic
962943214 3:140144499-140144521 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
963035580 3:141023403-141023425 CTCTTGAGCCTCAGAGGTGGAGG + Intergenic
963037134 3:141040555-141040577 TACCTGAGCCTGGGAGGTGGAGG - Intergenic
963128081 3:141833648-141833670 TACTTGAGCCCCTGAGGTGGAGG - Intergenic
963157179 3:142111312-142111334 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
963237856 3:142973192-142973214 TTCCAGAGACTCAGAGGAGTGGG - Intronic
963452608 3:145503344-145503366 TTTCTTAGCCACTGAGGATGTGG - Intergenic
963614367 3:147517185-147517207 TACCTAAGCCTCTGCAGAGGTGG + Intergenic
963800661 3:149672895-149672917 CGCCTCAGCCTCTGAGGAGCTGG + Intronic
964120266 3:153175882-153175904 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
964121632 3:153190423-153190445 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
964289717 3:155164058-155164080 TTCCTGAGCCTGAAAGGTGGAGG + Intronic
964339095 3:155689090-155689112 TTGCTGAGCCACTGGGGAGCTGG - Intronic
964362534 3:155913633-155913655 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
964619985 3:158711707-158711729 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
965016228 3:163161068-163161090 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
965110864 3:164420457-164420479 TGCTTGAACCTCTGAGGCGGAGG - Intergenic
965589007 3:170344741-170344763 ATCCTGAGCTTCTAAGGAGCTGG + Intergenic
965825783 3:172728141-172728163 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
965831553 3:172795211-172795233 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
965834153 3:172832547-172832569 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
966176557 3:177144637-177144659 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
966197899 3:177331682-177331704 TGCCTGAACCTGGGAGGAGGAGG - Intergenic
966606165 3:181823442-181823464 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
967857258 3:194127674-194127696 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
968083367 3:195862659-195862681 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
968152966 3:196353599-196353621 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
968209409 3:196836095-196836117 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
968362570 3:198157598-198157620 TTCCTGAGGAGCTGAGGAGAAGG - Intergenic
968569166 4:1330429-1330451 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
968721675 4:2211134-2211156 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
968783665 4:2602466-2602488 TGCCTTAGCCTCTGAGTAGCTGG + Intronic
968825265 4:2891331-2891353 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
969083985 4:4641727-4641749 TCCCGGAGCCTCCCAGGAGGAGG + Intergenic
969117710 4:4882328-4882350 TGCTTGAGCCTGTGAGGCGGAGG + Intergenic
969306068 4:6326990-6327012 CTCCTGAGCCTCTGAGGCCCTGG + Intronic
969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG + Intronic
969807861 4:9624731-9624753 TTCCTGGGCCCCTGAAGAAGCGG - Intergenic
969815948 4:9687535-9687557 TTCTTGAACCTGGGAGGAGGTGG + Intergenic
970469423 4:16361893-16361915 ATCCTGAGCCTCAGAGAAGTAGG - Intergenic
970682783 4:18530224-18530246 TTCCTGAGCCTGAGAGGTTGAGG + Intergenic
970885780 4:20986101-20986123 TTGCAGAGCCTCTGAAGAGTTGG - Intronic
971269650 4:25129506-25129528 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
971758453 4:30733539-30733561 TCCCTCAGCCTCTGAGTAGCTGG + Intronic
971819950 4:31539221-31539243 GTGCTCTGCCTCTGAGGAGGGGG + Intergenic
972498195 4:39653269-39653291 TGCTTGAGCCTCGGAGGTGGAGG - Intergenic
972501439 4:39681678-39681700 TGCCTCAGCCTCTGAGCAGTTGG + Intergenic
972771192 4:42198594-42198616 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
972962508 4:44471553-44471575 TTACTGCCCCACTGAGGAGGTGG + Intergenic
973313877 4:48739315-48739337 TGCCTGAACCTGGGAGGAGGAGG + Intronic
973321157 4:48811565-48811587 TTACTGAGCCTGGGAGGTGGAGG + Intronic
973979581 4:56296764-56296786 TTCCTGCCCCTGTGAGGAGCTGG + Intronic
973982780 4:56320056-56320078 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
973995544 4:56455041-56455063 TACCTCAGCCTCTGAGTAGCTGG - Intronic
974856683 4:67469458-67469480 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
975323154 4:73031430-73031452 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
976084038 4:81389000-81389022 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
976180844 4:82397235-82397257 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
976252302 4:83064997-83065019 TGCCTAAGCTTCTGGGGAGGTGG - Intronic
976294241 4:83454087-83454109 TGCCTGAGCCTCCGAGTAGCTGG - Intronic
976528332 4:86119479-86119501 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
977011817 4:91644807-91644829 TTCCAGAGTCTGTGGGGAGGGGG + Intergenic
977498360 4:97805320-97805342 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
978762515 4:112369566-112369588 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
978774901 4:112496133-112496155 TGCTTGAGCCTGAGAGGAGGAGG - Intergenic
979431662 4:120639700-120639722 TTCCTCAGCCTCTGAGTTGCTGG - Intergenic
979680148 4:123450496-123450518 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
980050005 4:128029871-128029893 TGCCTCAGCCTCTGAGTAGATGG - Intronic
980067221 4:128203106-128203128 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
980112583 4:128648874-128648896 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
980255196 4:130371299-130371321 TTCCTCAGCCTCTGAGTAGCTGG - Intergenic
980521836 4:133946166-133946188 TTTCTAAACCTCTCAGGAGGAGG + Intergenic
980828855 4:138105357-138105379 TTCCTGAGCCTGCGAGGCGGAGG + Intergenic
980851526 4:138388465-138388487 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
981006634 4:139881813-139881835 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
981078940 4:140618888-140618910 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
981343850 4:143652741-143652763 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
981420502 4:144544352-144544374 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
981468723 4:145103843-145103865 TACCTGAGCCTAGGAGGTGGAGG - Intronic
981903505 4:149893266-149893288 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
981931971 4:150199888-150199910 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
982769438 4:159382486-159382508 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
982992909 4:162301874-162301896 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
983867994 4:172790777-172790799 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
984238158 4:177186423-177186445 TTTCTCAGCCTCTGAGTAGCTGG - Intergenic
984509279 4:180659152-180659174 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
984807679 4:183766528-183766550 CTCCTGAGCCACTAAGTAGGTGG - Intergenic
984997784 4:185452809-185452831 TGCTTGAGCCTGTGAGGCGGAGG + Intronic
985543630 5:498514-498536 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
985920351 5:2966595-2966617 CCCCAGAGCCTCTCAGGAGGAGG - Intergenic
986340423 5:6784471-6784493 TACCTGGGCCTCAGGGGAGGAGG + Intergenic
986391750 5:7293696-7293718 TGCCTCAGCCTCCGAGGAGCTGG - Intergenic
986692702 5:10326834-10326856 TGCCTCAGCCTCTGAGTAGGTGG - Intergenic
986808245 5:11329267-11329289 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
986903270 5:12463311-12463333 TTACTGAGCCTGTGATGAGCTGG - Intergenic
987089767 5:14500380-14500402 TTCCTGAGCATCTGAGAACTGGG - Intronic
987120705 5:14764002-14764024 TGCCTGAGCCTGGGAGGCGGAGG + Intronic
987412823 5:17631732-17631754 CTCCTGGGACTCTGAGCAGGAGG + Intergenic
987827615 5:23054067-23054089 TTCCAGAGGCAATGAGGAGGGGG + Intergenic
988165726 5:27587333-27587355 TTCTTGAACCTGGGAGGAGGAGG - Intergenic
988572019 5:32377040-32377062 TTCCTCAGCCTCCGAGTAGCTGG - Intronic
988800935 5:34696250-34696272 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
988802959 5:34713917-34713939 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
988927930 5:36007944-36007966 CTCTTGAGCCTGTGAGGCGGAGG - Intergenic
989013096 5:36896711-36896733 TTCCTTAGCCTCCGAGTAGCTGG + Intronic
989191955 5:38679016-38679038 TGCCTGAGCCTGGGAGGTGGAGG + Intergenic
989234246 5:39126580-39126602 TACCTCAGCCTCTGAGCAGCTGG - Intronic
989241651 5:39209438-39209460 TGCCTCAGCCTCCGAGCAGGTGG + Intronic
989303135 5:39917807-39917829 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
989314629 5:40063400-40063422 TTCCAGAACCACTGAGGTGGAGG - Intergenic
989826667 5:45864917-45864939 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
990034504 5:51303513-51303535 TGCCTGAACCTGGGAGGAGGAGG + Intergenic
990571257 5:57081358-57081380 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
990631473 5:57674827-57674849 TTCCAGATCCTCTGAGAAGCAGG - Intergenic
990690349 5:58356706-58356728 TGCCTGAGCCTCTGAGGTGGTGG - Intergenic
990806495 5:59668592-59668614 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
990825188 5:59892067-59892089 TTCCTGTGCCTGTGTGGGGGAGG + Intronic
990911677 5:60858700-60858722 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
991350294 5:65713943-65713965 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
991474550 5:67005153-67005175 TGCCTGAGCCCCTCAGGAGCTGG + Intronic
992032846 5:72740560-72740582 TGCCGGAGCCTCGGGGGAGGAGG - Intergenic
992035158 5:72766515-72766537 TGCTTGAGCCTGTGAGGTGGAGG - Intergenic
992137504 5:73762079-73762101 TACCTCAGCCTCTGAGTAGCTGG + Intronic
992301888 5:75391077-75391099 TGCCTCAGCCTCTGAGTAGGTGG + Intronic
992578643 5:78147917-78147939 TGCCTCAGCCTCTGAGTAGTTGG - Intronic
992657860 5:78928427-78928449 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
992734874 5:79708818-79708840 TGCCTCAGCCTCCGAGGAGCTGG - Intronic
992818464 5:80469353-80469375 TTCCTCAGCCTCTGAGTAGTTGG + Intronic
992821727 5:80504632-80504654 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
992965313 5:81993540-81993562 TACCTCAGCCTCTGAGTAGCTGG + Intronic
993092575 5:83444272-83444294 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
993131565 5:83904942-83904964 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
993396463 5:87395753-87395775 TACCTGAGCCTCTCAGCAGCTGG - Intronic
993719611 5:91309562-91309584 TGCCTGAGCCTCAGAGGTTGAGG - Intergenic
994243469 5:97450893-97450915 TGCCTGAGCCTGAGAGGTGGAGG + Intergenic
994804790 5:104430988-104431010 GTCCTGAGCCTAGGAGGATGAGG + Intergenic
995494104 5:112723376-112723398 TGCTTGAGCCTGTGAGGCGGAGG + Intronic
995654880 5:114414498-114414520 TTCCTGAGGCTCTGCGGAGAGGG + Intronic
995717041 5:115090777-115090799 TGCTTGAACCTGTGAGGAGGAGG - Intergenic
996342800 5:122457083-122457105 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
996965875 5:129306660-129306682 GACCTGAGCCTCTGGGGAAGGGG - Intergenic
996972328 5:129386390-129386412 TGCTTGAACCTCGGAGGAGGAGG + Intergenic
997117356 5:131139445-131139467 TGCCTGAGCCCCAGAGGTGGAGG + Intergenic
997182216 5:131842081-131842103 TCCCTGAACCTGTGAGGTGGAGG - Intronic
997247803 5:132365744-132365766 TGCCTGAGCCTGGGAGGTGGAGG - Intergenic
997540352 5:134656593-134656615 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
997770713 5:136550390-136550412 TTCCCGTGCATCTGAGGAGAGGG + Intergenic
998102841 5:139448646-139448668 TTCCTGTGGCTCTGAGGAGGTGG + Exonic
998149755 5:139750209-139750231 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
998435375 5:142103694-142103716 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
998537015 5:142942892-142942914 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
999387387 5:151164167-151164189 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1000003806 5:157164903-157164925 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1000045451 5:157518466-157518488 TTCCTGAACCTGGGAGGCGGAGG - Intronic
1000179539 5:158794576-158794598 TTACTGACCCTTTGAGAAGGAGG - Intronic
1000284696 5:159816992-159817014 TGCTTGAGCCTGGGAGGAGGAGG - Intergenic
1000702691 5:164473171-164473193 TGCCTCAGCCTCTGAGAAGCTGG - Intergenic
1001122682 5:168993186-168993208 TTCCTCAGTCTCTTAGGAGAAGG - Intronic
1001146238 5:169187225-169187247 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1002525919 5:179816230-179816252 TGCTTGAGCCTCGGAGGCGGAGG - Intronic
1002595915 5:180322919-180322941 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1002606863 5:180388719-180388741 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1002920299 6:1564407-1564429 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1003014511 6:2457283-2457305 TGCCTGAACCTCGGAGGTGGAGG - Intergenic
1003077652 6:2997488-2997510 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1003229831 6:4242025-4242047 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1003294824 6:4816580-4816602 TGCCTGAGCCTGGGAGGTGGAGG - Intronic
1003358921 6:5404911-5404933 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1003620014 6:7691514-7691536 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1004280604 6:14276494-14276516 TGCCTGAGCCTCTGCTGTGGAGG + Intergenic
1004460982 6:15835626-15835648 TTCTTGAGCCTGGGAGGTGGAGG + Intergenic
1004705149 6:18117660-18117682 TGCCTTAGCCTCTGAGTAGCTGG - Intergenic
1004791804 6:19034887-19034909 TTCCTGAGCCTCACAGCATGGGG - Intergenic
1006013370 6:31060961-31060983 TTCCTCAGCCTCCGAGTAGCTGG + Intergenic
1006311101 6:33260884-33260906 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1006334822 6:33415020-33415042 AGCCAGAGCCCCTGAGGAGGAGG + Exonic
1006906919 6:37538956-37538978 TCCCACAGTCTCTGAGGAGGGGG - Intergenic
1006907057 6:37539616-37539638 ATCCCGGGCCTGTGAGGAGGAGG + Intergenic
1006912069 6:37570018-37570040 TTCCGGATCCTCTGAGGACCAGG + Intergenic
1007114231 6:39332059-39332081 TGCCTCAGCCTCTGAGTAGCTGG + Exonic
1007219987 6:40270789-40270811 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1007375993 6:41457051-41457073 TGCCTGACCCTCTGGGGAGCTGG - Intergenic
1007388784 6:41537669-41537691 TGCCTTAGCCTCTGAGTAGCTGG - Intergenic
1008004111 6:46391824-46391846 TACCTGAGACACTGAGGTGGAGG + Intronic
1008084851 6:47234103-47234125 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1008352443 6:50507901-50507923 CTCCTGAGCCTGGGAGGTGGAGG - Intergenic
1008394885 6:50994789-50994811 TCCATGTGCCTCTGAGGATGGGG - Intergenic
1008897315 6:56571059-56571081 TTCCTGAGTCTCTGTAGGGGAGG - Intronic
1009428052 6:63536214-63536236 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1009643195 6:66363197-66363219 TTCCTGGGCCTCTGAGAGTGCGG + Intergenic
1009862620 6:69354219-69354241 ATCCTGAACCTGTGGGGAGGGGG - Exonic
1009992622 6:70862891-70862913 TGCCTGAGCCTATGAGGTTGTGG + Intronic
1010797540 6:80134864-80134886 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1010888322 6:81271667-81271689 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1010940871 6:81916191-81916213 TTCCTGTTCCCCTGGGGAGGGGG - Intergenic
1011437620 6:87355475-87355497 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
1011539326 6:88413927-88413949 TGCCTCAGCCTCTGAGTAGTGGG + Intergenic
1011646192 6:89460548-89460570 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1012701467 6:102461815-102461837 TACCTCAGCCTCTGAGTAGCTGG - Intergenic
1012911954 6:105127872-105127894 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1012981920 6:105840147-105840169 CTCCTGAACATCTGAGGAAGAGG + Intergenic
1013233319 6:108175772-108175794 TTCCTGCGCCGCAGAGGAAGGGG - Intronic
1013352727 6:109319858-109319880 TCATTGAGCCTCTGAGGATGTGG + Intergenic
1013521954 6:110941518-110941540 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1013552697 6:111224123-111224145 TACCTCAGCCTCTGAGTAGCTGG - Intronic
1013829174 6:114252467-114252489 ATCCTGAACATCTGTGGAGGGGG + Intronic
1013988990 6:116230990-116231012 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1015850306 6:137565266-137565288 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1016406470 6:143736686-143736708 TGCCTGAGCCTCGGAGTAGCTGG + Intronic
1016714691 6:147211193-147211215 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1016971523 6:149768563-149768585 TACCTTAGCCTCTGAGTAGCTGG + Intronic
1017109110 6:150915712-150915734 GGCCTCAGCCTCTGAGTAGGTGG + Intronic
1017492910 6:154959853-154959875 CACCTGAGCCTCGGAGGCGGAGG - Intronic
1017778318 6:157696832-157696854 TCCATCAGCCTCTCAGGAGGTGG - Intergenic
1017924176 6:158896512-158896534 ATCCTGAGCTTCTGGGGAGGAGG + Intronic
1018465603 6:164041752-164041774 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1018524768 6:164696734-164696756 CTCCTGAGCATCTAAGGATGTGG - Intergenic
1018579896 6:165299796-165299818 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1018582281 6:165317496-165317518 GTTCTGTGCCTCTGAGGAGCGGG - Intergenic
1018748659 6:166782206-166782228 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1018768775 6:166954875-166954897 TGCCTCAGCCTCTGAGTAGGTGG - Intronic
1019028636 6:168992102-168992124 TGCCTGCCCCTCTGAGGATGAGG - Intergenic
1019253112 7:31109-31131 TTCCTGAGGAGCTGAGGAGAAGG + Intergenic
1019385229 7:751685-751707 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1019681282 7:2351241-2351263 TTTCTGAGCCTCTGAGGTGAAGG - Intronic
1020058358 7:5134119-5134141 CGCTTGAGCCTCTGAGGTGGAGG + Intergenic
1020130777 7:5557450-5557472 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1020147860 7:5658571-5658593 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
1021328759 7:19308437-19308459 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1021877644 7:25063573-25063595 TTCCTGAGCCTCTAAAGCAGCGG - Intergenic
1021882359 7:25107070-25107092 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1022014025 7:26333436-26333458 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1022200919 7:28116556-28116578 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1022627785 7:32055832-32055854 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1023294822 7:38703488-38703510 TCCCTGAGCCTGGGAGGGGGAGG + Intergenic
1023437876 7:40156899-40156921 TACCTCAGCCTCTGAGTAGCTGG - Intronic
1023462589 7:40415154-40415176 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1023928316 7:44687497-44687519 TGCTTGAGCCTCGGAGGTGGAGG - Intronic
1024620111 7:51149718-51149740 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1024931924 7:54673146-54673168 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1025095396 7:56092132-56092154 TTCCTGGGGGGCTGAGGAGGCGG + Intronic
1025734150 7:64132158-64132180 TGCCTCAGCCCCTGAGGAGCTGG + Intronic
1025907437 7:65798673-65798695 TTTGTGTGCCTCTGTGGAGGGGG + Intergenic
1025977546 7:66380893-66380915 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1026498524 7:70923504-70923526 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1026525015 7:71146059-71146081 TCCCTGAGCCAAAGAGGAGGTGG + Intronic
1026549492 7:71356089-71356111 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1026664430 7:72330207-72330229 TTCTTGAACCTCAGAGGTGGAGG + Intronic
1027012851 7:74761459-74761481 TGCCTGAACCTGTGAGGTGGAGG - Intergenic
1027203235 7:76076065-76076087 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1027756588 7:82221628-82221650 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1028102408 7:86837370-86837392 AGCCTGAGCCTCAGAGAAGGTGG + Intronic
1029173491 7:98647171-98647193 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1029211194 7:98909638-98909660 TTCCTGAGCCCCAGGGGTGGTGG + Intronic
1029477902 7:100795964-100795986 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1029490213 7:100866653-100866675 ATCCTGATCCTTGGAGGAGGAGG + Exonic
1030168700 7:106580131-106580153 TGCTTGAGCCTGTGAGGCGGAGG + Intergenic
1030306383 7:108022924-108022946 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
1031293271 7:119966926-119966948 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1031410006 7:121430250-121430272 TTCCTGAGCCTGAGAGGTAGAGG - Intergenic
1031967803 7:128040347-128040369 TGCTTGAGCCTGGGAGGAGGAGG + Intronic
1032262428 7:130347880-130347902 TGTGTGAGCCACTGAGGAGGGGG - Intronic
1032398954 7:131610431-131610453 TGCCCGGGCCTCTGAGGTGGCGG + Intergenic
1032581282 7:133105600-133105622 TGCCTGAGCCCTGGAGGAGGAGG + Intergenic
1033189337 7:139262598-139262620 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1033215297 7:139489121-139489143 CCTCTGAGCCTCTGAGCAGGTGG - Intergenic
1033406598 7:141074973-141074995 TTCATCAGCCTCTGAGAAGAAGG + Intronic
1033481358 7:141744323-141744345 TTCCTGTGCCTCTGTGGCCGGGG + Intronic
1033911139 7:146264335-146264357 TGTCTCAGCCTCTGAGGAGCTGG - Intronic
1034064510 7:148123481-148123503 TGCCTCAGCCTCTGGGCAGGAGG - Intronic
1034959454 7:155355912-155355934 TGCCTCAGCCTGTCAGGAGGAGG - Intergenic
1035114777 7:156515589-156515611 TTCCTGAGTCCCTGAGGGAGAGG + Intergenic
1035495692 7:159323723-159323745 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1035532698 8:366500-366522 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1035594179 8:841693-841715 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1035706742 8:1681572-1681594 TGCCTGAGCCCCAGAGGTGGAGG + Intronic
1035760199 8:2063278-2063300 TTCCTGAGCCAATCAAGAGGTGG - Intronic
1036693851 8:10961875-10961897 TTCTTGGGCCTCTCAGGTGGTGG - Intronic
1036799622 8:11780492-11780514 TGCCTTAGCCTCGGAGGAGCTGG + Intronic
1036824689 8:11966975-11966997 TTCCTGAGCCACTGATTAGCTGG - Intergenic
1037983973 8:23275190-23275212 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038184975 8:25264741-25264763 TTCTTGAACCTGGGAGGAGGAGG + Intronic
1038323735 8:26554002-26554024 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038326060 8:26573552-26573574 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1038435806 8:27535288-27535310 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1038447382 8:27613270-27613292 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1038993958 8:32900929-32900951 TGCCTCAGCCTCTGAGTAGTTGG + Intergenic
1039072769 8:33661350-33661372 CTCCTGAGCCTGGGAGGTGGAGG + Intergenic
1039084138 8:33763162-33763184 TGCCTCAGCCTCTGAGTAGTGGG + Intergenic
1039587407 8:38718831-38718853 TACCTCAGCCTCTGAGTAGCTGG + Intergenic
1039617859 8:38970682-38970704 TGCCTCAGCCTCTGAGTAGCTGG - Exonic
1039928270 8:41959045-41959067 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1039950947 8:42172304-42172326 TGCCTCAGCCTCAGAGTAGGTGG + Intergenic
1040101481 8:43510974-43510996 TTCCTGAGTCTCAGAGTGGGAGG - Intergenic
1040279769 8:46033721-46033743 TTCCTCAACCTCTGAGTAGCTGG - Intergenic
1040407574 8:47121214-47121236 TGCCTGAGCCTGGGAGGCGGAGG + Intergenic
1040861782 8:52007198-52007220 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1041020192 8:53631268-53631290 ATCATGAGCCTCAGAGGAGAGGG + Intergenic
1041049414 8:53918500-53918522 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1041722374 8:60987815-60987837 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1041822284 8:62050654-62050676 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1042234180 8:66591231-66591253 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1042320792 8:67473686-67473708 TGCCTGAGCCTGGGAGGCGGAGG - Intronic
1042855563 8:73263398-73263420 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1043240297 8:77924930-77924952 CGCCTGAACCTGTGAGGAGGAGG + Intergenic
1043580189 8:81703535-81703557 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1044393876 8:91685862-91685884 TCCCTCAGCCTCTGAGTAGCTGG - Intergenic
1044490250 8:92805186-92805208 CTCCAGAGCCTCTGGGGAGAGGG + Intergenic
1044659090 8:94578222-94578244 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1044669902 8:94668905-94668927 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1045351062 8:101340039-101340061 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1045519228 8:102888835-102888857 TTCTTGAGCCTCCGAGGTGGAGG + Intronic
1046006152 8:108488273-108488295 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1046357143 8:113102271-113102293 ATCTTGAGCCTCTAAGGAGATGG - Intronic
1046378414 8:113419230-113419252 TGCCTCAGCCTCTGAGTAGATGG + Intronic
1046936255 8:119887932-119887954 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1047119577 8:121886008-121886030 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1047272672 8:123376975-123376997 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1047824918 8:128562870-128562892 TTCTTGAGCCCCAGAGGTGGAGG - Intergenic
1047959499 8:130000576-130000598 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1048395573 8:134011083-134011105 AGCCTGTGCTTCTGAGGAGGGGG - Intergenic
1048439262 8:134447905-134447927 TTCCAGAGCCTCTGGGGTGCAGG + Intergenic
1048458682 8:134601889-134601911 AGCATGAGCCTCTGCGGAGGAGG + Exonic
1048904630 8:139075771-139075793 TGCCTCAGCCTCTGAGTAGTTGG - Intergenic
1049189561 8:141279249-141279271 ATCCTGGGCTTCTGAGTAGGCGG - Intronic
1049379664 8:142305637-142305659 TTTGTGAGCCTTTCAGGAGGAGG - Intronic
1049862409 8:144908776-144908798 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1050564011 9:6863679-6863701 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1050928557 9:11296978-11297000 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1051633360 9:19160007-19160029 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1052458395 9:28731102-28731124 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1052786628 9:32834127-32834149 TGCCTGGGCCTGTGTGGAGGAGG - Intergenic
1052797796 9:32939782-32939804 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1053005913 9:34604326-34604348 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1053199561 9:36143259-36143281 ATCCTGGGGCTCTGAAGAGGAGG - Intronic
1053316560 9:37057011-37057033 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1053422792 9:37990442-37990464 TTGCTGAGCATCTGTGGAGCTGG - Intronic
1054790474 9:69252076-69252098 CTCCTGAGCCTGAGAGGTGGAGG - Intronic
1054900669 9:70365779-70365801 TGCTTGAGCCTGGGAGGAGGAGG + Intergenic
1055041878 9:71883027-71883049 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1055098379 9:72437868-72437890 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1055177189 9:73334667-73334689 TGCTTGAGCCTAGGAGGAGGAGG - Intergenic
1055368915 9:75575813-75575835 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1055428029 9:76215823-76215845 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1056460224 9:86802135-86802157 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1057170052 9:92956949-92956971 TGCCTCAGCCTCTGAGTAGTTGG + Intronic
1057433805 9:95020832-95020854 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
1057639897 9:96809404-96809426 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1058002945 9:99885117-99885139 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1058113577 9:101058349-101058371 TGAGTGAGACTCTGAGGAGGTGG + Intronic
1058361453 9:104151354-104151376 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1058396578 9:104560423-104560445 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1059178666 9:112191257-112191279 TGCCTGAGCCTGGGAGGCGGAGG + Intergenic
1059242163 9:112815955-112815977 TGCCTCAGCCTCTGAGTAGTAGG + Intronic
1059296067 9:113271954-113271976 TGCCTGAGCTACTCAGGAGGCGG - Intronic
1060013255 9:120063447-120063469 TTCAGGAGTCTTTGAGGAGGCGG - Intergenic
1060119096 9:120971550-120971572 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1060226113 9:121791965-121791987 TTCCTGTGCATCTGGGGAGAGGG - Intergenic
1060597720 9:124858148-124858170 ATCCAGAGCCACTCAGGAGGAGG + Intronic
1060617864 9:125035239-125035261 TTCCTCAGACTCTGAGTAGCTGG - Intronic
1060699932 9:125741825-125741847 CTTCTGAGCCTGTCAGGAGGAGG - Intergenic
1061019461 9:128004668-128004690 CTCCTGAGCCTGGGAGGTGGAGG + Intergenic
1061076833 9:128346586-128346608 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1061266009 9:129505485-129505507 ATCCTGAGGCTCAGAGGATGGGG + Intergenic
1061276484 9:129571810-129571832 AGCCTGAGGCTCAGAGGAGGAGG - Intergenic
1061435327 9:130557711-130557733 TGCCTCAGCCTCTGAGTAGCTGG + Intergenic
1061881457 9:133571222-133571244 TCCCTGAACCTCTGAGGAATGGG - Intronic
1061913620 9:133737982-133738004 CCCCTGAGCCTGGGAGGAGGAGG - Intronic
1062595325 9:137296545-137296567 TCCCTGAGCCTGCGGGGAGGAGG - Intergenic
1062747258 9:138221257-138221279 TTCCTGAGGAGCTGAGGAGAAGG - Intergenic
1185514439 X:688574-688596 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1185514492 X:688885-688907 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1186383586 X:9086776-9086798 TTCCTGGACCTCTGAGTTGGGGG + Intronic
1186734749 X:12449903-12449925 TTCTTGAGCCTGGGAGGTGGAGG + Intronic
1186856539 X:13631671-13631693 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1187016846 X:15337395-15337417 TTGCTGAGTCTCTGTGGGGGAGG + Intergenic
1187230230 X:17414855-17414877 TTCCTCTGCCTCTGTGGAAGGGG - Intronic
1187384420 X:18834272-18834294 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1187499103 X:19823933-19823955 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1187541749 X:20203374-20203396 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1187685939 X:21815473-21815495 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1187710324 X:22046679-22046701 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1188391959 X:29631679-29631701 TGCCTCAGCCTCCGAGTAGGTGG - Intronic
1188654806 X:32680026-32680048 TGCCTCAGCCTCTGAGTAGCTGG + Intronic
1188852175 X:35145286-35145308 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1189443305 X:41057106-41057128 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1189811758 X:44787635-44787657 TGCCTCAGCCTCTGAGTAGGTGG + Intergenic
1189896970 X:45665619-45665641 TGCCTGGGCCTATGAGAAGGTGG + Intergenic
1189920312 X:45896904-45896926 TGCCTGAGCCTGGGGGGAGGAGG - Intergenic
1190322043 X:49185208-49185230 CTCCTGAGCTTCTGAAGAGAGGG - Intronic
1190751067 X:53361872-53361894 TTCTTCAGCCTCTGAGTGGGAGG + Intergenic
1191847185 X:65555733-65555755 TTCCTGAGTCTCTGAGTCAGTGG + Intergenic
1192443851 X:71195446-71195468 TTCTTGAACCTGGGAGGAGGAGG - Intergenic
1193333815 X:80264137-80264159 TGCCTCAGCCTCTGAGTAGCTGG - Intergenic
1193407255 X:81117336-81117358 TGCTTGAGCCTGGGAGGAGGAGG - Intronic
1193764519 X:85510184-85510206 TGCCTGAACCAGTGAGGAGGCGG + Intergenic
1195043611 X:101036329-101036351 TGTCTGAGCCTCTGAGTAGCTGG - Intronic
1196943954 X:120805830-120805852 CACCTGAGCCTCGGAGGTGGAGG - Intergenic
1197186888 X:123597575-123597597 CTCTTGAGCCTGTGAGGTGGAGG + Intergenic
1197721672 X:129749225-129749247 TTCCTGGGGCTCAGGGGAGGGGG + Intronic
1198093744 X:133357298-133357320 TGCCTGAGCCTGGGAGGTGGAGG + Intronic
1198218249 X:134576420-134576442 TGCCTCAGCCTCTGAGTAGCTGG - Intronic
1199069148 X:143456442-143456464 TTACTGTGGCTCTGAGGAGTGGG - Intergenic
1200329257 X:155278848-155278870 TGCTTGAGCCTCAGAGGTGGGGG + Intronic
1201060278 Y:10038254-10038276 TTCCTTGGCCTCTGGGGAGTTGG + Intergenic
1201575489 Y:15457229-15457251 TGCCTCAGCCTCTGAGTAGCGGG - Intergenic