ID: 969655714

View in Genome Browser
Species Human (GRCh38)
Location 4:8497104-8497126
Sequence AAAGCCCATTCCTTTAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969655714_969655715 5 Left 969655714 4:8497104-8497126 CCAAGGCTAAAGGAATGGGCTTT No data
Right 969655715 4:8497132-8497154 ACTCTTCCTTCTCCAGAGCAAGG No data
969655714_969655718 12 Left 969655714 4:8497104-8497126 CCAAGGCTAAAGGAATGGGCTTT No data
Right 969655718 4:8497139-8497161 CTTCTCCAGAGCAAGGTTGAGGG No data
969655714_969655717 11 Left 969655714 4:8497104-8497126 CCAAGGCTAAAGGAATGGGCTTT No data
Right 969655717 4:8497138-8497160 CCTTCTCCAGAGCAAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969655714 Original CRISPR AAAGCCCATTCCTTTAGCCT TGG (reversed) Intergenic
No off target data available for this crispr