ID: 969655718

View in Genome Browser
Species Human (GRCh38)
Location 4:8497139-8497161
Sequence CTTCTCCAGAGCAAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969655714_969655718 12 Left 969655714 4:8497104-8497126 CCAAGGCTAAAGGAATGGGCTTT No data
Right 969655718 4:8497139-8497161 CTTCTCCAGAGCAAGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969655718 Original CRISPR CTTCTCCAGAGCAAGGTTGA GGG Intergenic
No off target data available for this crispr