ID: 969657838

View in Genome Browser
Species Human (GRCh38)
Location 4:8508359-8508381
Sequence GGCACCCAGACCCACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969657838_969657846 11 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657846 4:8508393-8508415 CTGTTGTGTGGGTTATTGGTTGG No data
969657838_969657845 7 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657845 4:8508389-8508411 GTGTCTGTTGTGTGGGTTATTGG No data
969657838_969657848 17 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657848 4:8508399-8508421 TGTGGGTTATTGGTTGGGCCTGG No data
969657838_969657843 -1 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657843 4:8508381-8508403 CATGGGTTGTGTCTGTTGTGTGG No data
969657838_969657852 29 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657852 4:8508411-8508433 GTTGGGCCTGGGGAGCCCATGGG No data
969657838_969657851 28 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657851 4:8508410-8508432 GGTTGGGCCTGGGGAGCCCATGG No data
969657838_969657850 19 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657850 4:8508401-8508423 TGGGTTATTGGTTGGGCCTGGGG No data
969657838_969657844 0 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657844 4:8508382-8508404 ATGGGTTGTGTCTGTTGTGTGGG No data
969657838_969657847 12 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657847 4:8508394-8508416 TGTTGTGTGGGTTATTGGTTGGG No data
969657838_969657849 18 Left 969657838 4:8508359-8508381 CCCTGAGGGTGGGTCTGGGTGCC No data
Right 969657849 4:8508400-8508422 GTGGGTTATTGGTTGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969657838 Original CRISPR GGCACCCAGACCCACCCTCA GGG (reversed) Intergenic
No off target data available for this crispr