ID: 969658884

View in Genome Browser
Species Human (GRCh38)
Location 4:8514814-8514836
Sequence CTGAGCTTGGGGGCCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969658884_969658895 26 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658895 4:8514863-8514885 GTGGAGCACACAGGCATGTTGGG No data
969658884_969658892 7 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658884_969658896 29 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658896 4:8514866-8514888 GAGCACACAGGCATGTTGGGAGG No data
969658884_969658893 17 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658893 4:8514854-8514876 AGCAGCAGTGTGGAGCACACAGG No data
969658884_969658894 25 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658894 4:8514862-8514884 TGTGGAGCACACAGGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969658884 Original CRISPR CTGAGCTTGGGGGCCTTTGC AGG (reversed) Intergenic
No off target data available for this crispr