ID: 969658887

View in Genome Browser
Species Human (GRCh38)
Location 4:8514825-8514847
Sequence ACTATGTGGGCCTGAGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969658887_969658892 -4 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658887_969658894 14 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658894 4:8514862-8514884 TGTGGAGCACACAGGCATGTTGG No data
969658887_969658895 15 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658895 4:8514863-8514885 GTGGAGCACACAGGCATGTTGGG No data
969658887_969658898 26 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658898 4:8514874-8514896 AGGCATGTTGGGAGGAGACAGGG No data
969658887_969658897 25 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658897 4:8514873-8514895 CAGGCATGTTGGGAGGAGACAGG No data
969658887_969658896 18 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658896 4:8514866-8514888 GAGCACACAGGCATGTTGGGAGG No data
969658887_969658893 6 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658893 4:8514854-8514876 AGCAGCAGTGTGGAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969658887 Original CRISPR ACTATGTGGGCCTGAGCTTG GGG (reversed) Intergenic
No off target data available for this crispr