ID: 969658888

View in Genome Browser
Species Human (GRCh38)
Location 4:8514826-8514848
Sequence TACTATGTGGGCCTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969658888_969658899 30 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658899 4:8514879-8514901 TGTTGGGAGGAGACAGGGTGTGG No data
969658888_969658892 -5 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658888_969658893 5 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658893 4:8514854-8514876 AGCAGCAGTGTGGAGCACACAGG No data
969658888_969658898 25 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658898 4:8514874-8514896 AGGCATGTTGGGAGGAGACAGGG No data
969658888_969658894 13 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658894 4:8514862-8514884 TGTGGAGCACACAGGCATGTTGG No data
969658888_969658897 24 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658897 4:8514873-8514895 CAGGCATGTTGGGAGGAGACAGG No data
969658888_969658895 14 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658895 4:8514863-8514885 GTGGAGCACACAGGCATGTTGGG No data
969658888_969658896 17 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658896 4:8514866-8514888 GAGCACACAGGCATGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969658888 Original CRISPR TACTATGTGGGCCTGAGCTT GGG (reversed) Intergenic
No off target data available for this crispr