ID: 969658892

View in Genome Browser
Species Human (GRCh38)
Location 4:8514844-8514866
Sequence TAGTAAGAGCAGCAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969658889_969658892 -6 Left 969658889 4:8514827-8514849 CCAAGCTCAGGCCCACATAGTAA No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658884_969658892 7 Left 969658884 4:8514814-8514836 CCTGCAAAGGCCCCCAAGCTCAG No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658888_969658892 -5 Left 969658888 4:8514826-8514848 CCCAAGCTCAGGCCCACATAGTA No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658886_969658892 -3 Left 969658886 4:8514824-8514846 CCCCCAAGCTCAGGCCCACATAG No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data
969658887_969658892 -4 Left 969658887 4:8514825-8514847 CCCCAAGCTCAGGCCCACATAGT No data
Right 969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969658892 Original CRISPR TAGTAAGAGCAGCAGCAGTG TGG Intergenic
No off target data available for this crispr