ID: 969662252

View in Genome Browser
Species Human (GRCh38)
Location 4:8537118-8537140
Sequence CTGTGCTGCCTCTGCGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969662252_969662257 6 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662257 4:8537147-8537169 GGGAGATCTGCTTGTGCTGGTGG No data
969662252_969662258 12 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662258 4:8537153-8537175 TCTGCTTGTGCTGGTGGAGCTGG No data
969662252_969662259 13 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG No data
969662252_969662260 14 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662260 4:8537155-8537177 TGCTTGTGCTGGTGGAGCTGGGG No data
969662252_969662256 3 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662256 4:8537144-8537166 CCTGGGAGATCTGCTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969662252 Original CRISPR CTGTGCTGCCTCTGCGTCCC AGG (reversed) Intergenic
No off target data available for this crispr