ID: 969662259

View in Genome Browser
Species Human (GRCh38)
Location 4:8537154-8537176
Sequence CTGCTTGTGCTGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969662252_969662259 13 Left 969662252 4:8537118-8537140 CCTGGGACGCAGAGGCAGCACAG No data
Right 969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969662259 Original CRISPR CTGCTTGTGCTGGTGGAGCT GGG Intergenic
No off target data available for this crispr