ID: 969662396

View in Genome Browser
Species Human (GRCh38)
Location 4:8537924-8537946
Sequence GGTCATTGTGGATCAGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969662392_969662396 -10 Left 969662392 4:8537911-8537933 CCCCTGAGCTGGAGGTCATTGTG No data
Right 969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969662396 Original CRISPR GGTCATTGTGGATCAGACCC CGG Intergenic
No off target data available for this crispr